RPAP1 Polyclonal Antibody |
ABP60239-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RPAP1 protein at amino acid sequence of 260-340
- Applications tips:
|
Description: A polyclonal antibody for detection of RPAP1 from Human. This RPAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPAP1 protein at amino acid sequence of 260-340 |
RPAP1 antibody |
70R-50926 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RPAP1 antibody |
RPAP1 Antibody |
46216-100ul |
SAB |
100ul |
EUR 252 |
RPAP1 Antibody |
46216-50ul |
SAB |
50ul |
EUR 187 |
RPAP1 antibody |
70R-19951 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RPAP1 antibody |
RPAP1 Antibody |
DF9874 |
Affbiotech |
200ul |
EUR 304 |
Description: RPAP1 Antibody detects endogenous levels of total RPAP1. |
RPAP1 Antibody |
1-CSB-PA020094GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RPAP1. Recognizes RPAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RPAP1 Conjugated Antibody |
C46216 |
SAB |
100ul |
EUR 397 |
anti- RPAP1 antibody |
FNab07395 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: RNA polymerase II associated protein 1
- Uniprot ID: Q9BWH6
- Gene ID: 26015
- Research Area: Metabolism
|
Description: Antibody raised against RPAP1 |
anti- RPAP1 antibody |
FNab07396 |
FN Test |
100µg |
EUR 585 |
- Immunogen: RNA polymerase II associated protein 1
- Uniprot ID: Q9BWH6
- Gene ID: 26015
- Research Area: Metabolism
|
Description: Antibody raised against RPAP1 |
Anti-RPAP1 antibody |
STJ191346 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RPAP1 |
RPAP1 siRNA |
20-abx904639 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP1 siRNA |
20-abx931878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP1 siRNA |
20-abx931879 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP1 Blocking Peptide |
20-abx063801 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPAP1 Blocking Peptide |
DF9874-BP |
Affbiotech |
1mg |
EUR 195 |
RPAP1 cloning plasmid |
CSB-CL887140HU-10ug |
Cusabio |
10ug |
EUR 1641 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4182
- Sequence: atgctgtcgagaccgaagccaggggagtccgaggtggacctgctgcacttccagagtcagtttctcgcagctggtgcagccccagcagtgcagctggtgaagaaaggaaataggggcggtggtgatgccaactcagaccggcctccgctccaggaccatcgggatgtggtgatgt
- Show more
|
Description: A cloning plasmid for the RPAP1 gene. |
RNA polymerase II associated protein 1 (RPAP1) polyclonal antibody |
ABP-PAB-11687 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Mouse RPAP1 shRNA Plasmid |
20-abx976783 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RPAP1 shRNA Plasmid |
20-abx989666 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RPAP1 shRNA Plasmid |
20-abx958654 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RPAP1 ORF Vector (Human) (pORF) |
ORF008931 |
ABM |
1.0 ug DNA |
EUR 95 |
Rpap1 ORF Vector (Mouse) (pORF) |
ORF056294 |
ABM |
1.0 ug DNA |
EUR 1572 |
Rpap1 ORF Vector (Mouse) (pORF) |
ORF056295 |
ABM |
1.0 ug DNA |
EUR 1572 |
Rpap1 ORF Vector (Rat) (pORF) |
ORF075521 |
ABM |
1.0 ug DNA |
EUR 2080 |
RNA Polymerase II Associated Protein 1 (RPAP1) Antibody |
20-abx008210 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 1 (RPAP1) Antibody |
abx029304-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 1 (RPAP1) Antibody |
abx029304-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 1 (RPAP1) Antibody |
20-abx218344 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNA Polymerase II Associated Protein 1 (RPAP1) Antibody |
abx237395-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
RNA Polymerase II Associated Protein 1 (RPAP1) Antibody |
abx237396-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
RPAP1 sgRNA CRISPR Lentivector set (Human) |
K1871601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rpap1 sgRNA CRISPR Lentivector set (Mouse) |
K4890801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rpap1 sgRNA CRISPR Lentivector set (Rat) |
K6490501 |
ABM |
3 x 1.0 ug |
EUR 339 |
RPAP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1871602 |
ABM |
1.0 ug DNA |
EUR 154 |
RPAP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1871603 |
ABM |
1.0 ug DNA |
EUR 154 |
RPAP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1871604 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4890802 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4890803 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4890804 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6490502 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6490503 |
ABM |
1.0 ug DNA |
EUR 154 |
Rpap1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6490504 |
ABM |
1.0 ug DNA |
EUR 154 |
RPAP1 Protein Vector (Human) (pPB-C-His) |
PV035721 |
ABM |
500 ng |
EUR 329 |
RPAP1 Protein Vector (Human) (pPB-N-His) |
PV035722 |
ABM |
500 ng |
EUR 329 |
RPAP1 Protein Vector (Human) (pPM-C-HA) |
PV035723 |
ABM |
500 ng |
EUR 329 |
RPAP1 Protein Vector (Human) (pPM-C-His) |
PV035724 |
ABM |
500 ng |
EUR 329 |
RPAP1 Protein Vector (Rat) (pPB-C-His) |
PV302082 |
ABM |
500 ng |
EUR 2386 |
RPAP1 Protein Vector (Rat) (pPB-N-His) |
PV302083 |
ABM |
500 ng |
EUR 2386 |
RPAP1 Protein Vector (Rat) (pPM-C-HA) |
PV302084 |
ABM |
500 ng |
EUR 2386 |
RPAP1 Protein Vector (Rat) (pPM-C-His) |
PV302085 |
ABM |
500 ng |
EUR 2386 |
RPAP1 Protein Vector (Mouse) (pPB-C-His) |
PV225174 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPB-N-His) |
PV225175 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPM-C-HA) |
PV225176 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPM-C-His) |
PV225177 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPB-C-His) |
PV225178 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPB-N-His) |
PV225179 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPM-C-HA) |
PV225180 |
ABM |
500 ng |
EUR 2399 |
RPAP1 Protein Vector (Mouse) (pPM-C-His) |
PV225181 |
ABM |
500 ng |
EUR 2399 |
Rpap1 3'UTR GFP Stable Cell Line |
TU168056 |
ABM |
1.0 ml |
Ask for price |
RPAP1 3'UTR Luciferase Stable Cell Line |
TU020393 |
ABM |
1.0 ml |
EUR 1394 |
Rpap1 3'UTR Luciferase Stable Cell Line |
TU118056 |
ABM |
1.0 ml |
Ask for price |
RPAP1 3'UTR GFP Stable Cell Line |
TU070393 |
ABM |
1.0 ml |
EUR 1394 |
Rpap1 3'UTR Luciferase Stable Cell Line |
TU219599 |
ABM |
1.0 ml |
Ask for price |
Rpap1 3'UTR GFP Stable Cell Line |
TU269599 |
ABM |
1.0 ml |
Ask for price |
RPAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV681583 |
ABM |
1.0 ug DNA |
EUR 2232 |
RPAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV681587 |
ABM |
1.0 ug DNA |
EUR 2232 |
RPAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV681588 |
ABM |
1.0 ug DNA |
EUR 2232 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
RPAP1 Rabbit Polyclonal Antibody