RRAS2 Polyclonal Antibody |
ES10138-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RRAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RRAS2 Polyclonal Antibody |
ES10138-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RRAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RRAS2 Polyclonal Antibody |
ABP60259-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170 |
RRAS2 Polyclonal Antibody |
ABP60259-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170 |
RRAS2 Polyclonal Antibody |
ABP60259-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170 |
RRAS2 Rabbit pAb |
A7076-100ul |
Abclonal |
100 ul |
EUR 308 |
RRAS2 Rabbit pAb |
A7076-200ul |
Abclonal |
200 ul |
EUR 459 |
RRAS2 Rabbit pAb |
A7076-20ul |
Abclonal |
20 ul |
EUR 183 |
RRAS2 Rabbit pAb |
A7076-50ul |
Abclonal |
50 ul |
EUR 223 |
RRAS2 antibody |
70R-50868 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RRAS2 antibody |
RRAS2 Antibody |
40328-100ul |
SAB |
100ul |
EUR 252 |
RRAS2 antibody |
70R-20023 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RRAS2 antibody |
RRAS2 Antibody |
DF9840 |
Affbiotech |
200ul |
EUR 304 |
Description: RRAS2 Antibody detects endogenous levels of total RRAS2. |
RRAS2 Antibody |
1-CSB-PA350769 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
RRAS2 Antibody |
1-CSB-PA020514ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RRAS2 Antibody |
1-CSB-PA020514GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RRAS2 Conjugated Antibody |
C40328 |
SAB |
100ul |
EUR 397 |
anti- RRAS2 antibody |
FNab07490 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: related RAS viral(r-ras) oncogene homolog 2
- Uniprot ID: P62070
- Gene ID: 22800
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against RRAS2 |
Human RRAS2 Antibody |
32052-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-RRAS2 antibody |
STJ29156 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants. |
Anti-RRAS2 antibody |
STJ11100659 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants. |
Anti-RRAS2 antibody |
STJ191296 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RRAS2 |
RRAS2 siRNA |
20-abx932142 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RRAS2 siRNA |
20-abx932143 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RRAS2 |
YF-PA17610 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RRAS2 |
anti-RRAS2 |
YF-PA17611 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to RRAS2 |
RRAS2 cloning plasmid |
CSB-CL020514HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 615
- Sequence: atggccgcggccggctggcgggacggctccggccaggagaagtaccggctcgtggtggtcggcgggggcggcgtgggcaagtcggcgctcaccatccagttcatccagtcctattttgtaacggattatgatccaaccattgaagattcttacacaaagcagtgtgtgatagatga
- Show more
|
Description: A cloning plasmid for the RRAS2 gene. |
RRAS2 Blocking Peptide |
20-abx063743 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RRAS2 Mouse mAb |
A19466-100ul |
Abclonal |
100 ul |
Ask for price |
RRAS2 Mouse mAb |
A19466-200ul |
Abclonal |
200 ul |
Ask for price |
RRAS2 Mouse mAb |
A19466-20ul |
Abclonal |
20 ul |
Ask for price |
RRAS2 Mouse mAb |
A19466-50ul |
Abclonal |
50 ul |
EUR 308 |
RRAS2 Blocking Peptide |
DF9840-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal RRAS2 Antibody, Clone: 1578CT130.349.47.14 |
AMM02539G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human RRAS2. The antibodies are raised in Mouse and are from clone 1578CT130.349.47.14. This antibody is applicable in WB, E |
Human RRAS2 Antibody (Biotin Conjugate) |
32052-05121 |
AssayPro |
150 ug |
EUR 369 |
Mouse RRAS2 shRNA Plasmid |
20-abx975862 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RRAS2 shRNA Plasmid |
20-abx957779 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RRAS2 Rabbit Polyclonal Antibody