Biocat Net

Amine biocat 3.0

RRAS2 Rabbit Polyclonal Antibody

RRAS2 Polyclonal Antibody

ES10138-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RRAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RRAS2 Polyclonal Antibody

ES10138-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RRAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RRAS2 Polyclonal Antibody

ABP60259-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170

RRAS2 Polyclonal Antibody

ABP60259-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170

RRAS2 Polyclonal Antibody

ABP60259-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170

RRAS2 Rabbit pAb

A7076-100ul 100 ul
EUR 308

RRAS2 Rabbit pAb

A7076-200ul 200 ul
EUR 459

RRAS2 Rabbit pAb

A7076-20ul 20 ul
EUR 183

RRAS2 Rabbit pAb

A7076-50ul 50 ul
EUR 223

RRAS2 Antibody

ABD9840 100 ug
EUR 438

RRAS2 antibody

70R-50868 100 ul
EUR 244
Description: Purified Polyclonal RRAS2 antibody

RRAS2 Antibody

40328-100ul 100ul
EUR 252

RRAS2 antibody

70R-20023 50 ul
EUR 435
Description: Rabbit polyclonal RRAS2 antibody

RRAS2 Antibody

DF9840 200ul
EUR 304
Description: RRAS2 Antibody detects endogenous levels of total RRAS2.

RRAS2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

RRAS2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RRAS2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RRAS2 Conjugated Antibody

C40328 100ul
EUR 397

anti- RRAS2 antibody

FNab07490 100µg
EUR 548.75
  • Immunogen: related RAS viral(r-ras) oncogene homolog 2
  • Uniprot ID: P62070
  • Gene ID: 22800
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RRAS2

Human RRAS2 Antibody

32052-05111 150 ug
EUR 261

Anti-RRAS2 antibody

PAab07490 100 ug
EUR 386

Anti-RRAS2 antibody

STJ29156 100 µl
EUR 277
Description: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants.

Anti-RRAS2 antibody

STJ11100659 50 µl
EUR 287
Description: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants.

Anti-RRAS2 antibody

STJ191296 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RRAS2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17610 50 ul
EUR 363
Description: Mouse polyclonal to RRAS2


YF-PA17611 100 ug
EUR 403
Description: Rabbit polyclonal to RRAS2

RRAS2 cloning plasmid

CSB-CL020514HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 615
  • Sequence: atggccgcggccggctggcgggacggctccggccaggagaagtaccggctcgtggtggtcggcgggggcggcgtgggcaagtcggcgctcaccatccagttcatccagtcctattttgtaacggattatgatccaaccattgaagattcttacacaaagcagtgtgtgatagatga
  • Show more
Description: A cloning plasmid for the RRAS2 gene.

RRAS2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RRAS2 Mouse mAb

A19466-100ul 100 ul Ask for price

RRAS2 Mouse mAb

A19466-200ul 200 ul Ask for price

RRAS2 Mouse mAb

A19466-20ul 20 ul Ask for price

RRAS2 Mouse mAb

A19466-50ul 50 ul
EUR 308

RRAS2 Blocking Peptide

DF9840-BP 1mg
EUR 195


PVT14216 2 ug
EUR 495

Monoclonal RRAS2 Antibody, Clone: 1578CT130.349.47.14

AMM02539G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RRAS2. The antibodies are raised in Mouse and are from clone 1578CT130.349.47.14. This antibody is applicable in WB, E

Human RRAS2 Antibody (Biotin Conjugate)

32052-05121 150 ug
EUR 369

Mouse RRAS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002645 96 Tests
EUR 689

Human RRAS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RRAS2 Rabbit Polyclonal Antibody