Biocat Net

SF3A3 Polyclonal Antibody
ABP60373-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human SF3A3 protein Applications tips:
Description: A polyclonal antibody for detection of SF3A3 from Human, Mouse. This SF3A3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A3 protein

SF3A3 Polyclonal Antibody
ABP60373-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SF3A3 protein Applications tips:
Description: A polyclonal antibody for detection of SF3A3 from Human, Mouse. This SF3A3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A3 protein

SF3A3 Rabbit pAb
A4465-100ul	Abclonal	100 ul	EUR 308

SF3A3 Rabbit pAb
A4465-200ul	Abclonal	200 ul	EUR 459

SF3A3 Rabbit pAb
A4465-20ul	Abclonal	20 ul	EUR 183

SF3A3 Rabbit pAb
A4465-50ul	Abclonal	50 ul	EUR 223

SF3A3 antibody
70R-4856	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SF3A3 antibody raised against the middle region of SF3A3

SF3A3 Antibody
ABD2246	Lifescience Market	100 ug	EUR 438

SF3A3 Antibody
44691-100ul	SAB	100ul	EUR 252

SF3A3 Antibody
44691-50ul	SAB	50ul	EUR 187

SF3A3 Antibody
47199-100ul	SAB	100ul	EUR 252

SF3A3 antibody
70R-20194	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SF3A3 antibody

SF3A3 Antibody
DF2246	Affbiotech	200ul	EUR 304
Description: SF3A3 antibody detects endogenous levels of total SF3A3.

SF3A3 Antibody
1-CSB-PA021123GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SF3A3. Recognizes SF3A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

SF3A3 Conjugated Antibody
C44691	SAB	100ul	EUR 397

SF3A3 Conjugated Antibody
C47199	SAB	100ul	EUR 397

anti- SF3A3 antibody
FNab07776	FN Test	100µg	EUR 548.75
Immunogen: splicing factor 3a, subunit 3, 60kDa Uniprot ID: Q12874 Gene ID: 10946 Research Area: Neuroscience, Metabolism, Epigenetics
Description: Antibody raised against SF3A3

Anti-SF3A3 antibody
PAab07776	Lifescience Market	100 ug	EUR 386

Anti-SF3A3 antibody
STJ25497	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants.

Anti-SF3A3 antibody
STJ191464	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SF3A3

SF3A3 siRNA
20-abx933087	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SF3A3 siRNA
20-abx933088	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-SF3A3
PVT18376	Lifescience Market	2 ug	EUR 231

SF3A3 Blocking Peptide
33R-9103	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A3 antibody, catalog no. 70R-4856

SF3A3 Blocking Peptide
DF2246-BP	Affbiotech	1mg	EUR 195

SF3A3 cloning plasmid
CSB-CL619637HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1506 Sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgaggg Show more
Description: A cloning plasmid for the SF3A3 gene.

SF3A3 cloning plasmid
CSB-CL619637HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1506 Sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgaggg Show more
Description: A cloning plasmid for the SF3A3 gene.

pCMV-SPORT6-SF3A3
PVT13084	Lifescience Market	2 ug	EUR 391

Mouse SF3A3 shRNA Plasmid
20-abx978345	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SF3A3 ELISA KIT|Human
EF002852	Lifescience Market	96 Tests	EUR 689

Human SF3A3 shRNA Plasmid
20-abx957468	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SF3A3 Recombinant Protein (Human)
RP028273	ABM	100 ug	Ask for price

SF3A3 Recombinant Protein (Human)
RP028276	ABM	100 ug	Ask for price

SF3A3 Recombinant Protein (Rat)
RP228353	ABM	100 ug	Ask for price

SF3A3 Recombinant Protein (Mouse)
RP171320	ABM	100 ug	Ask for price

Anti-SF3A3 (2E9-2B7)
YF-MA17536	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to SF3A3

Splicing Factor 3A Subunit 3 (SF3A3) Antibody
20-abx003339	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Splicing Factor 3A Subunit 3 (SF3A3) Antibody
20-abx217922	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Splicing Factor 3A Subunit 3 (SF3A3) Antibody
abx237776-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SF3A3 ORF Vector (Human) (pORF)
ORF009425	ABM	1.0 ug DNA	EUR 95

SF3A3 ORF Vector (Human) (pORF)
ORF009426	ABM	1.0 ug DNA	EUR 95

Sf3a3 ORF Vector (Mouse) (pORF)
ORF057108	ABM	1.0 ug DNA	EUR 506

Sf3a3 ORF Vector (Rat) (pORF)
ORF076119	ABM	1.0 ug DNA	EUR 506

SF3A3 sgRNA CRISPR Lentivector set (Human)
K2130101	ABM	3 x 1.0 ug	EUR 339

Sf3a3 sgRNA CRISPR Lentivector set (Mouse)
K4123801	ABM	3 x 1.0 ug	EUR 339

Sf3a3 sgRNA CRISPR Lentivector set (Rat)
K7259001	ABM	3 x 1.0 ug	EUR 339

Splicing Factor 3A, Subunit 3, 60 kDa (SF3A3) Antibody
20-abx115795	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

SF3A3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2130102	ABM	1.0 ug DNA	EUR 154

SF3A3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2130103	ABM	1.0 ug DNA	EUR 154

SF3A3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2130104	ABM	1.0 ug DNA	EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4123802	ABM	1.0 ug DNA	EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4123803	ABM	1.0 ug DNA	EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4123804	ABM	1.0 ug DNA	EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7259002	ABM	1.0 ug DNA	EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7259003	ABM	1.0 ug DNA	EUR 154

Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7259004	ABM	1.0 ug DNA	EUR 154

SF3A3 Protein Vector (Human) (pPB-C-His)
PV037697	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPB-N-His)
PV037698	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPM-C-HA)
PV037699	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPM-C-His)
PV037700	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPB-C-His)
PV037701	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPB-N-His)
PV037702	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPM-C-HA)
PV037703	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Human) (pPM-C-His)
PV037704	ABM	500 ng	EUR 329

SF3A3 Protein Vector (Rat) (pPB-C-His)
PV304474	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Rat) (pPB-N-His)
PV304475	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Rat) (pPM-C-HA)
PV304476	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Rat) (pPM-C-His)
PV304477	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Mouse) (pPB-C-His)
PV228430	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Mouse) (pPB-N-His)
PV228431	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Mouse) (pPM-C-HA)
PV228432	ABM	500 ng	EUR 603

SF3A3 Protein Vector (Mouse) (pPM-C-His)
PV228433	ABM	500 ng	EUR 603

Sf3a3 3'UTR GFP Stable Cell Line
TU168679	ABM	1.0 ml	Ask for price

SF3A3 3'UTR Luciferase Stable Cell Line
TU023014	ABM	1.0 ml	EUR 1394

Sf3a3 3'UTR Luciferase Stable Cell Line
TU118679	ABM	1.0 ml	Ask for price

SF3A3 3'UTR GFP Stable Cell Line
TU073014	ABM	1.0 ml	EUR 1394

Sf3a3 3'UTR Luciferase Stable Cell Line
TU220223	ABM	1.0 ml	Ask for price

Sf3a3 3'UTR GFP Stable Cell Line
TU270223	ABM	1.0 ml	Ask for price

SF3A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV630889	ABM	1.0 ug DNA	EUR 682

SF3A3 Rabbit Polyclonal Antibody