SF3A3 Polyclonal Antibody |
ABP60373-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SF3A3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SF3A3 from Human, Mouse. This SF3A3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A3 protein |
SF3A3 Polyclonal Antibody |
ABP60373-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SF3A3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SF3A3 from Human, Mouse. This SF3A3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SF3A3 protein |
SF3A3 Rabbit pAb |
A4465-100ul |
Abclonal |
100 ul |
EUR 308 |
SF3A3 Rabbit pAb |
A4465-200ul |
Abclonal |
200 ul |
EUR 459 |
SF3A3 Rabbit pAb |
A4465-20ul |
Abclonal |
20 ul |
EUR 183 |
SF3A3 Rabbit pAb |
A4465-50ul |
Abclonal |
50 ul |
EUR 223 |
SF3A3 antibody |
70R-4856 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SF3A3 antibody raised against the middle region of SF3A3 |
SF3A3 Antibody |
44691-100ul |
SAB |
100ul |
EUR 252 |
SF3A3 Antibody |
44691-50ul |
SAB |
50ul |
EUR 187 |
SF3A3 Antibody |
47199-100ul |
SAB |
100ul |
EUR 252 |
SF3A3 antibody |
70R-20194 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SF3A3 antibody |
SF3A3 Antibody |
DF2246 |
Affbiotech |
200ul |
EUR 304 |
Description: SF3A3 antibody detects endogenous levels of total SF3A3. |
SF3A3 Antibody |
1-CSB-PA021123GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SF3A3. Recognizes SF3A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
SF3A3 Conjugated Antibody |
C44691 |
SAB |
100ul |
EUR 397 |
SF3A3 Conjugated Antibody |
C47199 |
SAB |
100ul |
EUR 397 |
anti- SF3A3 antibody |
FNab07776 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: splicing factor 3a, subunit 3, 60kDa
- Uniprot ID: Q12874
- Gene ID: 10946
- Research Area: Neuroscience, Metabolism, Epigenetics
|
Description: Antibody raised against SF3A3 |
Anti-SF3A3 antibody |
STJ25497 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. |
Anti-SF3A3 antibody |
STJ191464 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SF3A3 |
SF3A3 siRNA |
20-abx933087 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SF3A3 siRNA |
20-abx933088 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SF3A3 Blocking Peptide |
33R-9103 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SF3A3 antibody, catalog no. 70R-4856 |
SF3A3 Blocking Peptide |
DF2246-BP |
Affbiotech |
1mg |
EUR 195 |
SF3A3 cloning plasmid |
CSB-CL619637HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1506
- Sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgaggg
- Show more
|
Description: A cloning plasmid for the SF3A3 gene. |
SF3A3 cloning plasmid |
CSB-CL619637HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1506
- Sequence: atggagacaatactggagcagcagcggcgctatcatgaggagaaggaacggctcatggacgtcatggctaaagagatgctcaccaagaagtccacgctccgggaccagatcaattctgatcaccgcactcgggccatgcaagataggtatatggaggtcagtgggaacctgaggg
- Show more
|
Description: A cloning plasmid for the SF3A3 gene. |
Mouse SF3A3 shRNA Plasmid |
20-abx978345 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SF3A3 shRNA Plasmid |
20-abx957468 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SF3A3 Recombinant Protein (Human) |
RP028273 |
ABM |
100 ug |
Ask for price |
SF3A3 Recombinant Protein (Human) |
RP028276 |
ABM |
100 ug |
Ask for price |
SF3A3 Recombinant Protein (Rat) |
RP228353 |
ABM |
100 ug |
Ask for price |
SF3A3 Recombinant Protein (Mouse) |
RP171320 |
ABM |
100 ug |
Ask for price |
Anti-SF3A3 (2E9-2B7) |
YF-MA17536 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to SF3A3 |
Splicing Factor 3A Subunit 3 (SF3A3) Antibody |
20-abx003339 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Splicing Factor 3A Subunit 3 (SF3A3) Antibody |
20-abx217922 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Splicing Factor 3A Subunit 3 (SF3A3) Antibody |
abx237776-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
SF3A3 ORF Vector (Human) (pORF) |
ORF009425 |
ABM |
1.0 ug DNA |
EUR 95 |
SF3A3 ORF Vector (Human) (pORF) |
ORF009426 |
ABM |
1.0 ug DNA |
EUR 95 |
Sf3a3 ORF Vector (Mouse) (pORF) |
ORF057108 |
ABM |
1.0 ug DNA |
EUR 506 |
Sf3a3 ORF Vector (Rat) (pORF) |
ORF076119 |
ABM |
1.0 ug DNA |
EUR 506 |
SF3A3 sgRNA CRISPR Lentivector set (Human) |
K2130101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sf3a3 sgRNA CRISPR Lentivector set (Mouse) |
K4123801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sf3a3 sgRNA CRISPR Lentivector set (Rat) |
K7259001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Splicing Factor 3A, Subunit 3, 60 kDa (SF3A3) Antibody |
20-abx115795 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SF3A3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2130102 |
ABM |
1.0 ug DNA |
EUR 154 |
SF3A3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2130103 |
ABM |
1.0 ug DNA |
EUR 154 |
SF3A3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2130104 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4123802 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4123803 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4123804 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7259002 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7259003 |
ABM |
1.0 ug DNA |
EUR 154 |
Sf3a3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7259004 |
ABM |
1.0 ug DNA |
EUR 154 |
SF3A3 Protein Vector (Human) (pPB-C-His) |
PV037697 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPB-N-His) |
PV037698 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPM-C-HA) |
PV037699 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPM-C-His) |
PV037700 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPB-C-His) |
PV037701 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPB-N-His) |
PV037702 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPM-C-HA) |
PV037703 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Human) (pPM-C-His) |
PV037704 |
ABM |
500 ng |
EUR 329 |
SF3A3 Protein Vector (Rat) (pPB-C-His) |
PV304474 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Rat) (pPB-N-His) |
PV304475 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Rat) (pPM-C-HA) |
PV304476 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Rat) (pPM-C-His) |
PV304477 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Mouse) (pPB-C-His) |
PV228430 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Mouse) (pPB-N-His) |
PV228431 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Mouse) (pPM-C-HA) |
PV228432 |
ABM |
500 ng |
EUR 603 |
SF3A3 Protein Vector (Mouse) (pPM-C-His) |
PV228433 |
ABM |
500 ng |
EUR 603 |
Sf3a3 3'UTR GFP Stable Cell Line |
TU168679 |
ABM |
1.0 ml |
Ask for price |
SF3A3 3'UTR Luciferase Stable Cell Line |
TU023014 |
ABM |
1.0 ml |
EUR 1394 |
Sf3a3 3'UTR Luciferase Stable Cell Line |
TU118679 |
ABM |
1.0 ml |
Ask for price |
SF3A3 3'UTR GFP Stable Cell Line |
TU073014 |
ABM |
1.0 ml |
EUR 1394 |
Sf3a3 3'UTR Luciferase Stable Cell Line |
TU220223 |
ABM |
1.0 ml |
Ask for price |
Sf3a3 3'UTR GFP Stable Cell Line |
TU270223 |
ABM |
1.0 ml |
Ask for price |
SF3A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV630889 |
ABM |
1.0 ug DNA |
EUR 682 |
SF3A3 Rabbit Polyclonal Antibody