Biocat Net

Amine biocat 3.0

SOCS5 Rabbit Polyclonal Antibody

SOCS5 Rabbit pAb

A7952-100ul 100 ul
EUR 308

SOCS5 Rabbit pAb

A7952-200ul 200 ul
EUR 459

SOCS5 Rabbit pAb

A7952-20ul 20 ul
EUR 183

SOCS5 Rabbit pAb

A7952-50ul 50 ul
EUR 223

SOCS5 antibody

22879-100ul 100ul
EUR 390

SOCS5 antibody

70R-12836 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SOCS5 antibody

SOCS5 antibody

70R-20450 50 ul
EUR 435
Description: Rabbit polyclonal SOCS5 antibody

SOCS5 Antibody

35923-100ul 100ul
EUR 252

SOCS5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SOCS5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SOCS5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SOCS5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SOCS5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal SOCS5 Antibody (N-Term)

AMM07935G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SOCS5 (N-Term). This antibody is tested and proven to work in the following applications:

Anti-SOCS5 Antibody

A05989-1 100ug/vial
EUR 294

SOCS5 Conjugated Antibody

C35923 100ul
EUR 397

Anti-SOCS5 antibody

PAab08101 100 ug
EUR 386

Anti-SOCS5 antibody

STJ110261 100 µl
EUR 277
Description: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported.

Anti-SOCS5 antibody

STJ191478 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOCS5

Anti-SOCS5 antibody

STJ70271 100 µg
EUR 359


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16462 50 ul
EUR 363
Description: Mouse polyclonal to SOCS5


YF-PA16463 50 ug
EUR 363
Description: Mouse polyclonal to SOCS5


YF-PA16464 100 ul
EUR 403
Description: Rabbit polyclonal to SOCS5


YF-PA16465 100 ug
EUR 403
Description: Rabbit polyclonal to SOCS5


YF-PA25389 50 ul
EUR 334
Description: Mouse polyclonal to SOCS5

SOCS5 cloning plasmid

CSB-CL022394HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1611
  • Sequence: atggataaagtgggaaaaatgtggaataacttcaaatacaggtgtcagaatctcttcggtcatgagggaggaagccgtagtgaaaatgtggacatgaactccaacagatgtttgtctgtcaaagagaaaaacatcagcataggagactcaactcctcagcaacaaagcagtccct
  • Show more
Description: A cloning plasmid for the SOCS5 gene.

Anti-SOCS5 (2D1)

YF-MA11196 100 ug
EUR 363
Description: Mouse monoclonal to SOCS5


EF003128 96 Tests
EUR 689

Mouse SOCS5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SOCS5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SOCS5 Recombinant Protein (Rat)

RP230447 100 ug Ask for price

SOCS5 Recombinant Protein (Human)

RP029677 100 ug Ask for price

SOCS5 Recombinant Protein (Mouse)

RP174455 100 ug Ask for price

Monoclonal SOCS5 Antibody (monoclonal) (M01), Clone: 2D1

AMM07934G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SOCS5 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D1. This antibody is applicable in WB and IHC, E

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor Of Cytokine Signaling 5 (SOCS5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor Of Cytokine Signaling 5 (SOCS5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

abx122789-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

abx238101-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody

abx432015-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Socs5 ORF Vector (Rat) (pORF)

ORF076817 1.0 ug DNA
EUR 506

SOCS5 ORF Vector (Human) (pORF)

ORF009893 1.0 ug DNA
EUR 95

Socs5 ORF Vector (Mouse) (pORF)

ORF058153 1.0 ug DNA
EUR 506

Socs5 sgRNA CRISPR Lentivector set (Rat)

K6752101 3 x 1.0 ug
EUR 339

SOCS5 sgRNA CRISPR Lentivector set (Human)

K2257501 3 x 1.0 ug
EUR 339

Socs5 sgRNA CRISPR Lentivector set (Mouse)

K3953101 3 x 1.0 ug
EUR 339

Socs5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6752102 1.0 ug DNA
EUR 154

Socs5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6752103 1.0 ug DNA
EUR 154

Socs5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6752104 1.0 ug DNA
EUR 154

SOCS5 sgRNA CRISPR Lentivector (Human) (Target 1)

K2257502 1.0 ug DNA
EUR 154

SOCS5 sgRNA CRISPR Lentivector (Human) (Target 2)

K2257503 1.0 ug DNA
EUR 154

SOCS5 sgRNA CRISPR Lentivector (Human) (Target 3)

K2257504 1.0 ug DNA
EUR 154

Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3953102 1.0 ug DNA
EUR 154

Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3953103 1.0 ug DNA
EUR 154

Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3953104 1.0 ug DNA
EUR 154

SOCS5 Protein Vector (Rat) (pPB-C-His)

PV307266 500 ng
EUR 603

SOCS5 Protein Vector (Rat) (pPB-N-His)

PV307267 500 ng
EUR 603

SOCS5 Protein Vector (Rat) (pPM-C-HA)

PV307268 500 ng
EUR 603

SOCS5 Protein Vector (Rat) (pPM-C-His)

PV307269 500 ng
EUR 603

SOCS5 Protein Vector (Human) (pPB-C-His)

PV039569 500 ng
EUR 329

SOCS5 Protein Vector (Human) (pPB-N-His)

PV039570 500 ng
EUR 329

SOCS5 Protein Vector (Human) (pPM-C-HA)

PV039571 500 ng
EUR 329

SOCS5 Protein Vector (Human) (pPM-C-His)

PV039572 500 ng
EUR 329

SOCS5 Protein Vector (Mouse) (pPB-C-His)

PV232610 500 ng
EUR 603

SOCS5 Protein Vector (Mouse) (pPB-N-His)

PV232611 500 ng
EUR 603

SOCS5 Protein Vector (Mouse) (pPM-C-HA)

PV232612 500 ng
EUR 603

SOCS5 Protein Vector (Mouse) (pPM-C-His)

PV232613 500 ng
EUR 603

Socs5 3'UTR Luciferase Stable Cell Line

TU119455 1.0 ml Ask for price

Socs5 3'UTR GFP Stable Cell Line

TU169455 1.0 ml Ask for price

Socs5 3'UTR Luciferase Stable Cell Line

TU220959 1.0 ml Ask for price

Socs5 3'UTR GFP Stable Cell Line

TU270959 1.0 ml Ask for price

SOCS5 3'UTR GFP Stable Cell Line

TU074307 1.0 ml
EUR 2333

SOCS5 3'UTR Luciferase Stable Cell Line

TU024307 1.0 ml
EUR 2333

SOCS5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV624757 1.0 ug DNA
EUR 682

SOCS5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV624761 1.0 ug DNA
EUR 682

SOCS5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV624762 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

SOCS5 Rabbit Polyclonal Antibody