SOCS5 Rabbit Polyclonal Antibody

SOCS5 Rabbit pAb
A7952-100ul	Abclonal	100 ul	EUR 308

SOCS5 Rabbit pAb
A7952-200ul	Abclonal	200 ul	EUR 459

SOCS5 Rabbit pAb
A7952-20ul	Abclonal	20 ul	EUR 183

SOCS5 Rabbit pAb
A7952-50ul	Abclonal	50 ul	EUR 223

SOCS5 antibody
22879-100ul	SAB	100ul	EUR 390

SOCS5 antibody
70R-12836	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal SOCS5 antibody

SOCS5 antibody
70R-20450	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SOCS5 antibody

SOCS5 Antibody
35923-100ul	SAB	100ul	EUR 252

SOCS5 Antibody
1-CSB-PA796488	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SOCS5 Antibody
1-CSB-PA446167	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SOCS5 Antibody
1-CSB-PA022394ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SOCS5 Antibody
1-CSB-PA022394ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SOCS5 Antibody
1-CSB-PA022394GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal SOCS5 Antibody (N-Term)
AMM07935G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SOCS5 (N-Term). This antibody is tested and proven to work in the following applications:

Anti-SOCS5 Antibody
A05989-1	BosterBio	100ug/vial	EUR 294

SOCS5 Conjugated Antibody
C35923	SAB	100ul	EUR 397

Anti-SOCS5 antibody
PAab08101	Lifescience Market	100 ug	EUR 386

Anti-SOCS5 antibody
STJ110261	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported.

Anti-SOCS5 antibody
STJ191478	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SOCS5

Anti-SOCS5 antibody
STJ70271	St John's Laboratory	100 µg	EUR 359

SOCS5 siRNA
20-abx934654	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SOCS5 siRNA
20-abx934655	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SOCS5
YF-PA16462	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to SOCS5

anti-SOCS5
YF-PA16463	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SOCS5

anti-SOCS5
YF-PA16464	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to SOCS5

anti-SOCS5
YF-PA16465	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SOCS5

anti-SOCS5
YF-PA25389	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SOCS5

SOCS5 cloning plasmid
CSB-CL022394HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1611 Sequence: atggataaagtgggaaaaatgtggaataacttcaaatacaggtgtcagaatctcttcggtcatgagggaggaagccgtagtgaaaatgtggacatgaactccaacagatgtttgtctgtcaaagagaaaaacatcagcataggagactcaactcctcagcaacaaagcagtccct Show more
Description: A cloning plasmid for the SOCS5 gene.

Anti-SOCS5 (2D1)
YF-MA11196	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SOCS5

SOCS5 ELISA KIT|Human
EF003128	Lifescience Market	96 Tests	EUR 689

Mouse SOCS5 shRNA Plasmid
20-abx974795	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SOCS5 shRNA Plasmid
20-abx956432	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SOCS5 Recombinant Protein (Rat)
RP230447	ABM	100 ug	Ask for price

SOCS5 Recombinant Protein (Human)
RP029677	ABM	100 ug	Ask for price

SOCS5 Recombinant Protein (Mouse)
RP174455	ABM	100 ug	Ask for price

Monoclonal SOCS5 Antibody (monoclonal) (M01), Clone: 2D1
AMM07934G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human SOCS5 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D1. This antibody is applicable in WB and IHC, E

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
20-abx006047	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Suppressor Of Cytokine Signaling 5 (SOCS5) Antibody
20-abx212667	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Suppressor Of Cytokine Signaling 5 (SOCS5) Antibody
20-abx212937	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
20-abx115908	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
abx122789-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
abx238101-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
20-abx321293	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
20-abx322069	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Suppressor of Cytokine Signaling 5 (SOCS5) Antibody
abx432015-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Socs5 ORF Vector (Rat) (pORF)
ORF076817	ABM	1.0 ug DNA	EUR 506

SOCS5 ORF Vector (Human) (pORF)
ORF009893	ABM	1.0 ug DNA	EUR 95

Socs5 ORF Vector (Mouse) (pORF)
ORF058153	ABM	1.0 ug DNA	EUR 506

Socs5 sgRNA CRISPR Lentivector set (Rat)
K6752101	ABM	3 x 1.0 ug	EUR 339

SOCS5 sgRNA CRISPR Lentivector set (Human)
K2257501	ABM	3 x 1.0 ug	EUR 339

Socs5 sgRNA CRISPR Lentivector set (Mouse)
K3953101	ABM	3 x 1.0 ug	EUR 339

Socs5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6752102	ABM	1.0 ug DNA	EUR 154

Socs5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6752103	ABM	1.0 ug DNA	EUR 154

Socs5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6752104	ABM	1.0 ug DNA	EUR 154

SOCS5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2257502	ABM	1.0 ug DNA	EUR 154

SOCS5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2257503	ABM	1.0 ug DNA	EUR 154

SOCS5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2257504	ABM	1.0 ug DNA	EUR 154

Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3953102	ABM	1.0 ug DNA	EUR 154

Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3953103	ABM	1.0 ug DNA	EUR 154

Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3953104	ABM	1.0 ug DNA	EUR 154

SOCS5 Protein Vector (Rat) (pPB-C-His)
PV307266	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Rat) (pPB-N-His)
PV307267	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Rat) (pPM-C-HA)
PV307268	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Rat) (pPM-C-His)
PV307269	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Human) (pPB-C-His)
PV039569	ABM	500 ng	EUR 329

SOCS5 Protein Vector (Human) (pPB-N-His)
PV039570	ABM	500 ng	EUR 329

SOCS5 Protein Vector (Human) (pPM-C-HA)
PV039571	ABM	500 ng	EUR 329

SOCS5 Protein Vector (Human) (pPM-C-His)
PV039572	ABM	500 ng	EUR 329

SOCS5 Protein Vector (Mouse) (pPB-C-His)
PV232610	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Mouse) (pPB-N-His)
PV232611	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Mouse) (pPM-C-HA)
PV232612	ABM	500 ng	EUR 603

SOCS5 Protein Vector (Mouse) (pPM-C-His)
PV232613	ABM	500 ng	EUR 603

Socs5 3'UTR Luciferase Stable Cell Line
TU119455	ABM	1.0 ml	Ask for price

Socs5 3'UTR GFP Stable Cell Line
TU169455	ABM	1.0 ml	Ask for price

Socs5 3'UTR Luciferase Stable Cell Line
TU220959	ABM	1.0 ml	Ask for price

Socs5 3'UTR GFP Stable Cell Line
TU270959	ABM	1.0 ml	Ask for price

SOCS5 3'UTR GFP Stable Cell Line
TU074307	ABM	1.0 ml	EUR 2333

SOCS5 3'UTR Luciferase Stable Cell Line
TU024307	ABM	1.0 ml	EUR 2333

SOCS5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV624757	ABM	1.0 ug DNA	EUR 682

SOCS5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV624761	ABM	1.0 ug DNA	EUR 682

SOCS5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV624762	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

SOCS5 Rabbit Polyclonal Antibody