Biocat Net

Amine biocat 3.0

SPAG5 Rabbit Polyclonal Antibody

SPAG5 Rabbit pAb

A6451-100ul 100 ul
EUR 308

SPAG5 Rabbit pAb

A6451-200ul 200 ul
EUR 459

SPAG5 Rabbit pAb

A6451-20ul 20 ul
EUR 183

SPAG5 Rabbit pAb

A6451-50ul 50 ul
EUR 223

SPAG5 Antibody

ABD9944 100 ug
EUR 438

SPAG5 Antibody

35928-100ul 100ul
EUR 252

SPAG5 antibody

38929-100ul 100ul
EUR 252

SPAG5 antibody

70R-20473 50 ul
EUR 435
Description: Rabbit polyclonal SPAG5 antibody

SPAG5 Antibody

DF9944 200ul
EUR 304
Description: SPAG5 Antibody detects endogenous levels of total SPAG5.

SPAG5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SPAG5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SPAG5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SPAG5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SPAG5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF, IP

SPAG5 Conjugated Antibody

C35928 100ul
EUR 397

anti- SPAG5 antibody

FNab08143 100µg
EUR 585
  • Immunogen: sperm associated antigen 5
  • Uniprot ID: Q96R06
  • Gene ID: 10615
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against SPAG5

Anti-SPAG5 antibody

PAab08143 100 ug
EUR 412

Anti-SPAG5 antibody

STJ116304 100 µl
EUR 277
Description: This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles.

Anti-SPAG5 antibody

STJ191462 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPAG5


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Sperm associated antigen 5 (SPAG5) polyclonal antibody

ABP-PAB-10269 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

SPAG5 cloning plasmid

CSB-CL853491HU-10ug 10ug
EUR 1267
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3582
  • Sequence: atgtggcgagtgaaaaaactgagcctcagcctgtcgccttcgccccagacgggaaaaccatctatgagaactcctctccgtgaacttaccctgcagcccggtgccctcaccaactctggaaaaagatcccccgcttgctcctcgctgaccccatcactgtgcaagctggggctgc
  • Show more
Description: A cloning plasmid for the SPAG5 gene.

SPAG5 Blocking Peptide

DF9944-BP 1mg
EUR 195

pDONR223-SPAG5 Plasmid

PVTB00569 2 ug
EUR 356

Mouse SPAG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF007340 96 Tests
EUR 689

Human SPAG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

abx122796-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

abx238143-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal SPAG5 Antibody (monoclonal) (M01), Clone: 5F9

AMM04124G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human SPAG5 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 5F9. This antibody is applicable in WB

Spag5 ORF Vector (Mouse) (pORF)

ORF058240 1.0 ug DNA
EUR 506

SPAG5 ORF Vector (Human) (pORF)

ORF009921 1.0 ug DNA
EUR 95

Spag5 ORF Vector (Rat) (pORF)

ORF076873 1.0 ug DNA
EUR 506

SPAG5 ELISA Kit (Human) (OKWB00200)

OKWB00200 96 Wells
EUR 572
Description: Description of target: Essential component of the mitotic spindle required for normal chromosome segregation and progression into anaphase. Required for chromosome alignment, normal timing of sister chromatid segregation, and maintenance of spindle pole architecture. In complex with SKAP, promotes stable microtubule-kinetochore attachments. May contribute to the regulation of separase activity. May regulate AURKA localization to mitotic spindle, but not to centrosomes and CCNB1 localization to both mitotic spindle and centrosomes. Involved in centriole duplication. Required for CDK5RAP2, CEP152, WDR62 and CEP63 centrosomal localization and promotes the centrosomal localization of CDK2. In non-mitotic cells, upon stress induction, inhibits mammalian target of rapamycin complex 1 (mTORC1) association and recruits the mTORC1 component RPTOR to stress granules (SGs), thereby preventing mTORC1 hyperactivation-induced apoptosis. May enhance GSK3B-mediated phosphorylation of other substrates, such as MAPT/TAU.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

SPAG5 sgRNA CRISPR Lentivector set (Human)

K2264301 3 x 1.0 ug
EUR 339

Spag5 sgRNA CRISPR Lentivector set (Mouse)

K4343101 3 x 1.0 ug
EUR 339

Spag5 sgRNA CRISPR Lentivector set (Rat)

K7268801 3 x 1.0 ug
EUR 339

SPAG5-AS1 ORF Vector (Human) (pORF)

ORF033214 1.0 ug DNA Ask for price

SPAG5 sgRNA CRISPR Lentivector (Human) (Target 1)

K2264302 1.0 ug DNA
EUR 154

SPAG5 sgRNA CRISPR Lentivector (Human) (Target 2)

K2264303 1.0 ug DNA
EUR 154

SPAG5 sgRNA CRISPR Lentivector (Human) (Target 3)

K2264304 1.0 ug DNA
EUR 154

Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4343102 1.0 ug DNA
EUR 154

Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4343103 1.0 ug DNA
EUR 154

Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4343104 1.0 ug DNA
EUR 154

Spag5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7268802 1.0 ug DNA
EUR 154

Spag5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7268803 1.0 ug DNA
EUR 154

Spag5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7268804 1.0 ug DNA
EUR 154

SPAG5 Protein Vector (Human) (pPB-C-His)

PV039681 500 ng
EUR 329

SPAG5 Protein Vector (Human) (pPB-N-His)

PV039682 500 ng
EUR 329

SPAG5 Protein Vector (Human) (pPM-C-HA)

PV039683 500 ng
EUR 329

SPAG5 Protein Vector (Human) (pPM-C-His)

PV039684 500 ng
EUR 329

SPAG5 Protein Vector (Rat) (pPB-C-His)

PV307490 500 ng
EUR 1166

SPAG5 Protein Vector (Rat) (pPB-N-His)

PV307491 500 ng
EUR 1166

SPAG5 Protein Vector (Rat) (pPM-C-HA)

PV307492 500 ng
EUR 1166

SPAG5 Protein Vector (Rat) (pPM-C-His)

PV307493 500 ng
EUR 1166

SPAG5 Protein Vector (Mouse) (pPB-C-His)

PV232958 500 ng
EUR 1065

SPAG5 Protein Vector (Mouse) (pPB-N-His)

PV232959 500 ng
EUR 1065

SPAG5 Protein Vector (Mouse) (pPM-C-HA)

PV232960 500 ng
EUR 1065

SPAG5 Protein Vector (Mouse) (pPM-C-His)

PV232961 500 ng
EUR 1065

Spag5 3'UTR GFP Stable Cell Line

TU169519 1.0 ml Ask for price

Spag5 3'UTR Luciferase Stable Cell Line

TU119519 1.0 ml Ask for price

SPAG5 3'UTR GFP Stable Cell Line

TU074375 1.0 ml
EUR 1394

SPAG5 3'UTR Luciferase Stable Cell Line

TU024375 1.0 ml
EUR 1394

Spag5 3'UTR Luciferase Stable Cell Line

TU221020 1.0 ml Ask for price

Spag5 3'UTR GFP Stable Cell Line

TU271020 1.0 ml Ask for price

Human SPAG5(sperm associated antigen 5) ELISA Kit

EH4134 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96R06
  • Alias: Astrin/Deepest/Mitotic spindle-associated protein p126/MAP126
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sperm- associated antigen 5, SPAG5 ELISA KIT

ELI-18254h 96 Tests
EUR 824

Mouse Sperm- associated antigen 5, Spag5 ELISA KIT

ELI-39527m 96 Tests
EUR 865

Human Sperm Associated Antigen 5 (SPAG5) ELISA Kit

abx257271-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

SPAG5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV631195 1.0 ug DNA
EUR 1355

SPAG5 Rabbit Polyclonal Antibody