 SPEG Polyclonal Antibody |
|
ABP60491-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SPEG protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPEG from Human, Mouse, Rat. This SPEG antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPEG protein |
SPEG Polyclonal Antibody |
|
ABP60491-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SPEG protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPEG from Human, Mouse, Rat. This SPEG antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPEG protein |
SPEG Polyclonal Antibody |
|
ABP60491-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SPEG protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPEG from Human, Mouse, Rat. This SPEG antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPEG protein |
) Polyclonal APEG1 / SPEG Antibody (internal region) |
|
APG00823G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APEG1 / SPEG (internal region). This antibody is tested and proven to work in the following applications: |
 Anti-SPEG antibody |
|
STJ191475 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SPEG |
 SPEG siRNA |
|
20-abx905239 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPEG siRNA |
|
20-abx934924 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPEG siRNA |
|
20-abx934925 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 SPEG cloning plasmid |
|
CSB-CL623013HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 342
- Sequence: atgaagcccagtcccagccagaaccgccgttcttctgacactggctccaaggcaccccccaccttcaaggtctcacttatggaccagtcagtaagagaaggccaagatgtcatcatgagcatccgcgtgcagggggagcccaagcctgtggtctcctggctgagaaaccgccagcc
- Show more
|
|
Description: A cloning plasmid for the SPEG gene. |
 Rat SPEG shRNA Plasmid |
|
20-abx990530 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SPEG shRNA Plasmid |
|
20-abx956971 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse SPEG shRNA Plasmid |
|
20-abx969178 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 h SPEG inducible lentiviral particles |
|
LVP120 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, SPEG, is fully sequence verified and matched to NCBI accession ID: NM_005876 |
 (pORF)) Speg ORF Vector (Mouse) (pORF) |
|
ORF058312 |
ABM |
1.0 ug DNA |
EUR 3527 |
Speg ORF Vector (Mouse) (pORF) |
|
ORF058313 |
ABM |
1.0 ug DNA |
EUR 2744 |
Speg ORF Vector (Mouse) (pORF) |
|
ORF058314 |
ABM |
1.0 ug DNA |
EUR 506 |
Speg ORF Vector (Mouse) (pORF) |
|
ORF058315 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SPEG ORF Vector (Human) (pORF) |
|
ORF009954 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Speg ORF Vector (Rat) (pORF) |
|
ORF076914 |
ABM |
1.0 ug DNA |
EUR 3524 |
Speg ORF Vector (Rat) (pORF) |
|
ORF076915 |
ABM |
1.0 ug DNA |
EUR 506 |
) SPEG sgRNA CRISPR Lentivector set (Human) |
|
K2271201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Speg sgRNA CRISPR Lentivector set (Mouse) |
|
K3919701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Speg sgRNA CRISPR Lentivector set (Rat) |
|
K7139401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) SPEG sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2271202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SPEG sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2271203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SPEG sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2271204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Speg sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3919702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Speg sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3919703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Speg sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3919704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Speg sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7139402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Speg sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7139403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Speg sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7139404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SPEG Protein Vector (Human) (pPB-C-His) |
|
PV039813 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SPEG Protein Vector (Human) (pPB-N-His) |
|
PV039814 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SPEG Protein Vector (Human) (pPM-C-HA) |
|
PV039815 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SPEG Protein Vector (Human) (pPM-C-His) |
|
PV039816 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SPEG Protein Vector (Rat) (pPB-C-His) |
|
PV307654 |
ABM |
500 ng |
EUR 5216 |
 (pPB-N-His)) SPEG Protein Vector (Rat) (pPB-N-His) |
|
PV307655 |
ABM |
500 ng |
EUR 5216 |
 (pPM-C-HA)) SPEG Protein Vector (Rat) (pPM-C-HA) |
|
PV307656 |
ABM |
500 ng |
EUR 5216 |
 (pPM-C-His)) SPEG Protein Vector (Rat) (pPM-C-His) |
|
PV307657 |
ABM |
500 ng |
EUR 5216 |
SPEG Protein Vector (Rat) (pPB-C-His) |
|
PV307658 |
ABM |
500 ng |
EUR 603 |
SPEG Protein Vector (Rat) (pPB-N-His) |
|
PV307659 |
ABM |
500 ng |
EUR 603 |
SPEG Protein Vector (Rat) (pPM-C-HA) |
|
PV307660 |
ABM |
500 ng |
EUR 603 |
SPEG Protein Vector (Rat) (pPM-C-His) |
|
PV307661 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SPEG Protein Vector (Mouse) (pPB-C-His) |
|
PV233246 |
ABM |
500 ng |
EUR 5220 |
 (pPB-N-His)) SPEG Protein Vector (Mouse) (pPB-N-His) |
|
PV233247 |
ABM |
500 ng |
EUR 5220 |
 (pPM-C-HA)) SPEG Protein Vector (Mouse) (pPM-C-HA) |
|
PV233248 |
ABM |
500 ng |
EUR 5220 |
 (pPM-C-His)) SPEG Protein Vector (Mouse) (pPM-C-His) |
|
PV233249 |
ABM |
500 ng |
EUR 5220 |
SPEG Protein Vector (Mouse) (pPB-C-His) |
|
PV233250 |
ABM |
500 ng |
EUR 4101 |
SPEG Protein Vector (Mouse) (pPB-N-His) |
|
PV233251 |
ABM |
500 ng |
EUR 4101 |
SPEG Protein Vector (Mouse) (pPM-C-HA) |
|
PV233252 |
ABM |
500 ng |
EUR 4101 |
SPEG Protein Vector (Mouse) (pPM-C-His) |
|
PV233253 |
ABM |
500 ng |
EUR 4101 |
SPEG Protein Vector (Mouse) (pPB-C-His) |
|
PV233254 |
ABM |
500 ng |
EUR 1065 |
SPEG Protein Vector (Mouse) (pPB-N-His) |
|
PV233255 |
ABM |
500 ng |
EUR 1065 |
SPEG Protein Vector (Mouse) (pPM-C-HA) |
|
PV233256 |
ABM |
500 ng |
EUR 1065 |
SPEG Protein Vector (Mouse) (pPM-C-His) |
|
PV233257 |
ABM |
500 ng |
EUR 1065 |
SPEG Protein Vector (Mouse) (pPB-C-His) |
|
PV233258 |
ABM |
500 ng |
EUR 603 |
SPEG Protein Vector (Mouse) (pPB-N-His) |
|
PV233259 |
ABM |
500 ng |
EUR 603 |
SPEG Protein Vector (Mouse) (pPM-C-HA) |
|
PV233260 |
ABM |
500 ng |
EUR 603 |
SPEG Protein Vector (Mouse) (pPM-C-His) |
|
PV233261 |
ABM |
500 ng |
EUR 603 |
 Speg 3'UTR GFP Stable Cell Line |
|
TU169570 |
ABM |
1.0 ml |
Ask for price |
 Speg 3'UTR Luciferase Stable Cell Line |
|
TU119570 |
ABM |
1.0 ml |
Ask for price |
 SPEG 3'UTR GFP Stable Cell Line |
|
TU074446 |
ABM |
1.0 ml |
EUR 1394 |
 SPEG 3'UTR Luciferase Stable Cell Line |
|
TU024446 |
ABM |
1.0 ml |
EUR 1394 |
Speg 3'UTR Luciferase Stable Cell Line |
|
TU221061 |
ABM |
1.0 ml |
Ask for price |
Speg 3'UTR GFP Stable Cell Line |
|
TU271061 |
ABM |
1.0 ml |
Ask for price |
) Human Striated muscle preferentially expressed protein kinase (SPEG) |
|
1-CSB-EP022529HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 38.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Striated muscle preferentially expressed protein kinase(SPEG),partial expressed in E.coli |
 (CMV) (pLenti-GIII-CMV)) SPEG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV665917 |
ABM |
1.0 ug DNA |
EUR 4819 |
 (UbC) (pLenti-GIII-UbC)) SPEG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV665921 |
ABM |
1.0 ug DNA |
EUR 4819 |
 (EF1a) (pLenti-GIII-EF1a)) SPEG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV665922 |
ABM |
1.0 ug DNA |
EUR 4819 |
SPEG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV667927 |
ABM |
1.0 ug DNA |
EUR 514 |
SPEG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV667931 |
ABM |
1.0 ug DNA |
EUR 514 |
SPEG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV667932 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
SPEG Rabbit Polyclonal Antibody
