Biocat Net

Amine biocat 3.0

SPEG Rabbit Polyclonal Antibody

SPEG Polyclonal Antibody

ABP60491-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SPEG protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPEG from Human, Mouse, Rat. This SPEG antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPEG protein

SPEG Polyclonal Antibody

ABP60491-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPEG protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPEG from Human, Mouse, Rat. This SPEG antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPEG protein

SPEG Polyclonal Antibody

ABP60491-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPEG protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPEG from Human, Mouse, Rat. This SPEG antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPEG protein

Polyclonal APEG1 / SPEG Antibody (internal region)

APG00823G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APEG1 / SPEG (internal region). This antibody is tested and proven to work in the following applications:

Speg/ Rat Speg ELISA Kit

ELI-52856r 96 Tests
EUR 886

Anti-SPEG antibody

STJ191475 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPEG


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-APEG1 / SPEG antibody

STJ72801 100 µg
EUR 260

SPEG cloning plasmid

CSB-CL623013HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Sequence: atgaagcccagtcccagccagaaccgccgttcttctgacactggctccaaggcaccccccaccttcaaggtctcacttatggaccagtcagtaagagaaggccaagatgtcatcatgagcatccgcgtgcagggggagcccaagcctgtggtctcctggctgagaaaccgccagcc
  • Show more
Description: A cloning plasmid for the SPEG gene.

Rat SPEG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-39502h 96 Tests
EUR 824

Mouse Speg ELISA KIT

ELI-42553m 96 Tests
EUR 865

Human SPEG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SPEG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

h SPEG inducible lentiviral particles

LVP120 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, SPEG, is fully sequence verified and matched to NCBI accession ID: NM_005876

Speg ORF Vector (Mouse) (pORF)

ORF058312 1.0 ug DNA
EUR 3527

Speg ORF Vector (Mouse) (pORF)

ORF058313 1.0 ug DNA
EUR 2744

Speg ORF Vector (Mouse) (pORF)

ORF058314 1.0 ug DNA
EUR 506

Speg ORF Vector (Mouse) (pORF)

ORF058315 1.0 ug DNA
EUR 506

SPEG ORF Vector (Human) (pORF)

ORF009954 1.0 ug DNA
EUR 95

Speg ORF Vector (Rat) (pORF)

ORF076914 1.0 ug DNA
EUR 3524

Speg ORF Vector (Rat) (pORF)

ORF076915 1.0 ug DNA
EUR 506

SPEG sgRNA CRISPR Lentivector set (Human)

K2271201 3 x 1.0 ug
EUR 339

Speg sgRNA CRISPR Lentivector set (Mouse)

K3919701 3 x 1.0 ug
EUR 339

Speg sgRNA CRISPR Lentivector set (Rat)

K7139401 3 x 1.0 ug
EUR 339

SPEG sgRNA CRISPR Lentivector (Human) (Target 1)

K2271202 1.0 ug DNA
EUR 154

SPEG sgRNA CRISPR Lentivector (Human) (Target 2)

K2271203 1.0 ug DNA
EUR 154

SPEG sgRNA CRISPR Lentivector (Human) (Target 3)

K2271204 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3919702 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3919703 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3919704 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Rat) (Target 1)

K7139402 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Rat) (Target 2)

K7139403 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Rat) (Target 3)

K7139404 1.0 ug DNA
EUR 154

SPEG Protein Vector (Human) (pPB-C-His)

PV039813 500 ng
EUR 329

SPEG Protein Vector (Human) (pPB-N-His)

PV039814 500 ng
EUR 329

SPEG Protein Vector (Human) (pPM-C-HA)

PV039815 500 ng
EUR 329

SPEG Protein Vector (Human) (pPM-C-His)

PV039816 500 ng
EUR 329

SPEG Protein Vector (Rat) (pPB-C-His)

PV307654 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPB-N-His)

PV307655 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPM-C-HA)

PV307656 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPM-C-His)

PV307657 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPB-C-His)

PV307658 500 ng
EUR 603

SPEG Protein Vector (Rat) (pPB-N-His)

PV307659 500 ng
EUR 603

SPEG Protein Vector (Rat) (pPM-C-HA)

PV307660 500 ng
EUR 603

SPEG Protein Vector (Rat) (pPM-C-His)

PV307661 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPB-C-His)

PV233246 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPB-N-His)

PV233247 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPM-C-HA)

PV233248 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPM-C-His)

PV233249 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPB-C-His)

PV233250 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPB-N-His)

PV233251 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPM-C-HA)

PV233252 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPM-C-His)

PV233253 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPB-C-His)

PV233254 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPB-N-His)

PV233255 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPM-C-HA)

PV233256 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPM-C-His)

PV233257 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPB-C-His)

PV233258 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPB-N-His)

PV233259 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPM-C-HA)

PV233260 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPM-C-His)

PV233261 500 ng
EUR 603

Speg 3'UTR GFP Stable Cell Line

TU169570 1.0 ml Ask for price

Speg 3'UTR Luciferase Stable Cell Line

TU119570 1.0 ml Ask for price

SPEG 3'UTR GFP Stable Cell Line

TU074446 1.0 ml
EUR 1394

SPEG 3'UTR Luciferase Stable Cell Line

TU024446 1.0 ml
EUR 1394

Speg 3'UTR Luciferase Stable Cell Line

TU221061 1.0 ml Ask for price

Speg 3'UTR GFP Stable Cell Line

TU271061 1.0 ml Ask for price

Human Striated muscle preferentially expressed protein kinase (SPEG)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Striated muscle preferentially expressed protein kinase(SPEG),partial expressed in E.coli

SPEG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665917 1.0 ug DNA
EUR 4819

SPEG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665921 1.0 ug DNA
EUR 4819

SPEG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665922 1.0 ug DNA
EUR 4819

SPEG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667927 1.0 ug DNA
EUR 514

SPEG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667931 1.0 ug DNA
EUR 514

SPEG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667932 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SPEG Rabbit Polyclonal Antibody