SRP54 Polyclonal Antibody |
ABP60513-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SRP54 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SRP54 from Human, Mouse, Rat. This SRP54 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SRP54 protein |
SRP54 Polyclonal Antibody |
ABP60513-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SRP54 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SRP54 from Human, Mouse, Rat. This SRP54 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SRP54 protein |
SRP54 Polyclonal Antibody |
A63498 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
SRP54 Rabbit pAb |
A4126-100ul |
Abclonal |
100 ul |
EUR 308 |
SRP54 Rabbit pAb |
A4126-200ul |
Abclonal |
200 ul |
EUR 459 |
SRP54 Rabbit pAb |
A4126-20ul |
Abclonal |
20 ul |
EUR 183 |
SRP54 Rabbit pAb |
A4126-50ul |
Abclonal |
50 ul |
EUR 223 |
SRP54 antibody |
70R-4849 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SRP54 antibody raised against the middle region of SRP54 |
SRP54 Antibody |
40106-100ul |
SAB |
100ul |
EUR 252 |
SRP54 antibody |
70R-20523 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SRP54 antibody |
SRP54 Antibody |
DF12479 |
Affbiotech |
200ul |
EUR 304 |
Description: SRP54 antibody detects endogenous levels of SRP54. |
SRP54 Antibody |
1-CSB-PA228089 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
SRP54 Antibody |
1-CSB-PA080227 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
SRP54 Antibody |
1-CSB-PA022675GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
SRP54 Antibody |
1-CSB-PA022675LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
SRP54 Polyclonal Antibody, HRP Conjugated |
A63499 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
SRP54 Polyclonal Antibody, FITC Conjugated |
A63500 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SRP54 Polyclonal Antibody, Biotin Conjugated |
A63501 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
SRP54 Conjugated Antibody |
C40106 |
SAB |
100ul |
EUR 397 |
anti- SRP54 antibody |
FNab08232 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:500-1:1000
- IHC:1:20-1:200
- Immunogen: signal recognition particle 54kDa
- Uniprot ID: P61011
- Gene ID: 6729
- Research Area: Epigenetics, Signal Transduction, Metabolism
|
Description: Antibody raised against SRP54 |
anti- SRP54 antibody |
FNab08233 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: signal recognition particle 54kDa
- Uniprot ID: P61011
- Gene ID: 6729
- Research Area: Epigenetics, Signal Transduction, Metabolism
|
Description: Antibody raised against SRP54 |
Anti-SRP54 antibody |
STJ191418 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SRP54 |
SRP54 siRNA |
20-abx935170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRP54 siRNA |
20-abx935171 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRP54 Antibody, HRP conjugated |
1-CSB-PA022675LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SRP54 Antibody, FITC conjugated |
1-CSB-PA022675LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SRP54 Antibody, Biotin conjugated |
1-CSB-PA022675LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SRP54 cloning plasmid |
CSB-CL022675HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1515
- Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcgttgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
- Show more
|
Description: A cloning plasmid for the SRP54 gene. |
SRP54 cloning plasmid |
CSB-CL022675HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1515
- Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcattgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
- Show more
|
Description: A cloning plasmid for the SRP54 gene. |
SRP54 Rabbit Polyclonal Antibody