SRP54 Rabbit Polyclonal Antibody

SRP54 Polyclonal Antibody

ABP60513-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SRP54 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SRP54 from Human, Mouse, Rat. This SRP54 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SRP54 protein

SRP54 Polyclonal Antibody

ABP60513-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SRP54 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SRP54 from Human, Mouse, Rat. This SRP54 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SRP54 protein

SRP54 Polyclonal Antibody

A63498 100 µg
EUR 570.55
Description: Ask the seller for details

SRP54 Rabbit pAb

A4126-100ul 100 ul
EUR 308

SRP54 Rabbit pAb

A4126-200ul 200 ul
EUR 459

SRP54 Rabbit pAb

A4126-20ul 20 ul
EUR 183

SRP54 Rabbit pAb

A4126-50ul 50 ul
EUR 223

SRP54 antibody

70R-4849 50 ug
EUR 467
Description: Rabbit polyclonal SRP54 antibody raised against the middle region of SRP54

SRP54 Antibody

40106-100ul 100ul
EUR 252

SRP54 antibody

70R-20523 50 ul
EUR 435
Description: Rabbit polyclonal SRP54 antibody

SRP54 Antibody

DF12479 200ul
EUR 304
Description: SRP54 antibody detects endogenous levels of SRP54.

SRP54 Antibody

1-CSB-PA228089
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

SRP54 Antibody

1-CSB-PA080227
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SRP54 Antibody

1-CSB-PA022675GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SRP54 Antibody

1-CSB-PA022675LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

SRP54 Polyclonal Antibody, HRP Conjugated

A63499 100 µg
EUR 570.55
Description: The best epigenetics products

SRP54 Polyclonal Antibody, FITC Conjugated

A63500 100 µg
EUR 570.55
Description: kits suitable for this type of research

SRP54 Polyclonal Antibody, Biotin Conjugated

A63501 100 µg
EUR 570.55
Description: fast delivery possible

Srp54/ Rat Srp54 ELISA Kit

ELI-29869r 96 Tests
EUR 886

SRP54 Conjugated Antibody

C40106 100ul
EUR 397

anti- SRP54 antibody

FNab08232 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC:1:20-1:200
  • Immunogen: signal recognition particle 54kDa
  • Uniprot ID: P61011
  • Gene ID: 6729
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against SRP54

anti- SRP54 antibody

FNab08233 100µg
EUR 548.75
  • Immunogen: signal recognition particle 54kDa
  • Uniprot ID: P61011
  • Gene ID: 6729
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against SRP54

Anti-SRP54 antibody

PAab08232 100 ug
EUR 386

Anti-SRP54 antibody

PAab08233 100 ug
EUR 386

Anti-SRP54 antibody

STJ25695 100 µl
EUR 277

Anti-SRP54 antibody

STJ191418 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SRP54

SRP54 siRNA

20-abx935170
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRP54 siRNA

20-abx935171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRP54 Antibody, HRP conjugated

1-CSB-PA022675LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SRP54 Antibody, FITC conjugated

1-CSB-PA022675LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SRP54 Antibody, Biotin conjugated

1-CSB-PA022675LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SRP54 cloning plasmid

CSB-CL022675HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcgttgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
  • Show more
Description: A cloning plasmid for the SRP54 gene.

SRP54 cloning plasmid

CSB-CL022675HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcattgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
  • Show more
Description: A cloning plasmid for the SRP54 gene.

SRP54 Rabbit Polyclonal Antibody