 SRPK2 Polyclonal Antibody |
|
ES10216-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SRPK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 SRPK2 Rabbit pAb |
|
A17536-100ul |
Abclonal |
100 ul |
EUR 308 |
SRPK2 Rabbit pAb |
|
A17536-200ul |
Abclonal |
200 ul |
EUR 459 |
SRPK2 Rabbit pAb |
|
A17536-20ul |
Abclonal |
20 ul |
EUR 183 |
SRPK2 Rabbit pAb |
|
A17536-50ul |
Abclonal |
50 ul |
EUR 223 |
 SRPK2 Antibody |
|
46226-100ul |
SAB |
100ul |
EUR 252 |
SRPK2 Antibody |
|
46226-50ul |
SAB |
50ul |
EUR 187 |
SRPK2 Antibody |
|
DF9889 |
Affbiotech |
200ul |
EUR 304 |
|
Description: SRPK2 Antibody detects endogenous levels of total SRPK2. |
SRPK2 Antibody |
|
1-CSB-PA022683LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 SRPK2 Conjugated Antibody |
|
C46226 |
SAB |
100ul |
EUR 397 |
 Anti-SRPK2 antibody |
|
STJ191374 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SRPK2 |
 SRPK2 siRNA |
|
20-abx935179 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRPK2 siRNA |
|
20-abx935180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SRPK2 |
|
YF-PA14780 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to SRPK2 |
 SRPK2 Antibody, HRP conjugated |
|
1-CSB-PA022683LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 SRPK2 Antibody, FITC conjugated |
|
1-CSB-PA022683LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 SRPK2 Antibody, Biotin conjugated |
|
1-CSB-PA022683LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Polyclonal Antibody (Human)) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human) |
|
4-PAH132Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2) |
 SRPK2 Blocking Peptide |
|
DF9889-BP |
Affbiotech |
1mg |
EUR 195 |
 SRPK2 cloning plasmid |
|
CSB-CL022683HU1-10ug |
Cusabio |
10ug |
EUR 688 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2067
- Sequence: atgtcagttaactctgagaagtcgtcctcttcagaaaggccggagcctcaacagaaagctcctttagttcctcctcctccaccgccaccaccaccaccaccgccacctttgccagaccccacacccccggagccagaggaggagatcctgggatcagatgatgaggagcaagagg
- Show more
|
|
Description: A cloning plasmid for the SRPK2 gene. |
SRPK2 cloning plasmid |
|
CSB-CL022683HU2-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2067
- Sequence: atgtcagttaactctgagaagtcgtcctcttcagaaaggccggagcctcaacagaaagctcctttagttcctcctcctccaccgccaccaccaccaccaccgccacctttgccagaccccacacccccggagccagaggaggagatcctgggatcagatgatgaggagcaagagg
- Show more
|
|
Description: A cloning plasmid for the SRPK2 gene. |
 Mouse Serine/threonine- protein kinase SRPK2, Srpk2 ELISA KIT |
|
ELI-52680m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Serine/threonine- protein kinase SRPK2, SRPK2 ELISA KIT |
|
ELI-42502h |
Lifescience Market |
96 Tests |
EUR 824 |
 Polyclonal Antibody (Human), APC) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), APC |
|
4-PAH132Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAH132Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), Cy3 |
|
4-PAH132Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), FITC |
|
4-PAH132Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), HRP |
|
4-PAH132Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), PE |
|
4-PAH132Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with PE. |
 Mouse SRPK2 shRNA Plasmid |
|
20-abx972893 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SRPK2 shRNA Plasmid |
|
20-abx954600 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) SRSF Protein Kinase 2 (SRPK2) Antibody |
|
20-abx218763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SRSF Protein Kinase 2 (SRPK2) Antibody |
|
20-abx128040 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAH132Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SRPK2 (Glu380~Leu617)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with APC-Cy7. |
 (pORF)) Srpk2 ORF Vector (Rat) (pORF) |
|
ORF077026 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SRPK2 ORF Vector (Human) (pORF) |
|
ORF010036 |
ABM |
1.0 ug DNA |
EUR 95 |
SRPK2 ORF Vector (Human) (pORF) |
|
ORF010037 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Srpk2 ORF Vector (Mouse) (pORF) |
|
ORF058485 |
ABM |
1.0 ug DNA |
EUR 506 |
) Srpk2 sgRNA CRISPR Lentivector set (Rat) |
|
K7603401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Srpk2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3767801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SRPK2 sgRNA CRISPR Lentivector set (Human) |
|
K2286901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Recombinant SRSF Protein Kinase 2 (SRPK2) |
|
4-RPH132Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78362
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.3kDa
- Isoelectric Point: 4.6
|
|
Description: Recombinant Human SRSF Protein Kinase 2 expressed in: E.coli |
 Protein) Human SRSF Protein Kinase 2 (SRPK2) Protein |
|
20-abx165866 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) Srpk2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7603402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Srpk2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7603403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Srpk2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7603404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Srpk2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3767802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Srpk2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3767803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Srpk2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3767804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SRPK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2286902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SRPK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2286903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SRPK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2286904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SRPK2 Protein Vector (Rat) (pPB-C-His) |
|
PV308102 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) SRPK2 Protein Vector (Rat) (pPB-N-His) |
|
PV308103 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) SRPK2 Protein Vector (Rat) (pPM-C-HA) |
|
PV308104 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) SRPK2 Protein Vector (Rat) (pPM-C-His) |
|
PV308105 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) SRPK2 Protein Vector (Human) (pPB-C-His) |
|
PV040141 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SRPK2 Protein Vector (Human) (pPB-N-His) |
|
PV040142 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SRPK2 Protein Vector (Human) (pPM-C-HA) |
|
PV040143 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SRPK2 Protein Vector (Human) (pPM-C-His) |
|
PV040144 |
ABM |
500 ng |
EUR 329 |
SRPK2 Protein Vector (Human) (pPB-C-His) |
|
PV040145 |
ABM |
500 ng |
EUR 329 |
SRPK2 Protein Vector (Human) (pPB-N-His) |
|
PV040146 |
ABM |
500 ng |
EUR 329 |
SRPK2 Protein Vector (Human) (pPM-C-HA) |
|
PV040147 |
ABM |
500 ng |
EUR 329 |
SRPK2 Protein Vector (Human) (pPM-C-His) |
|
PV040148 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SRPK2 Protein Vector (Mouse) (pPB-C-His) |
|
PV233938 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) SRPK2 Protein Vector (Mouse) (pPB-N-His) |
|
PV233939 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) SRPK2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV233940 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) SRPK2 Protein Vector (Mouse) (pPM-C-His) |
|
PV233941 |
ABM |
500 ng |
EUR 1065 |
 Srpk2 3'UTR Luciferase Stable Cell Line |
|
TU119698 |
ABM |
1.0 ml |
Ask for price |
 Srpk2 3'UTR GFP Stable Cell Line |
|
TU169698 |
ABM |
1.0 ml |
Ask for price |
Srpk2 3'UTR Luciferase Stable Cell Line |
|
TU221183 |
ABM |
1.0 ml |
Ask for price |
 SRPK2 3'UTR GFP Stable Cell Line |
|
TU074612 |
ABM |
1.0 ml |
EUR 1394 |
Srpk2 3'UTR GFP Stable Cell Line |
|
TU271183 |
ABM |
1.0 ml |
Ask for price |
 SRPK2 3'UTR Luciferase Stable Cell Line |
|
TU024612 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) SRPK2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV715437 |
ABM |
1.0 ug DNA |
EUR 316 |
 (UbC) (pLenti-GIII-UbC)) SRPK2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV715441 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) SRPK2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV715442 |
ABM |
1.0 ug DNA |
EUR 316 |
 (CMV) (pLenti-GIII-CMV)) SRPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV640075 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) SRPK2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV640079 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) SRPK2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV640080 |
ABM |
1.0 ug DNA |
EUR 1355 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
SRPK2 Rabbit Polyclonal Antibody