SRPK2 Rabbit Polyclonal Antibody

SRPK2 Polyclonal Antibody

ES10216-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SRPK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SRPK2 Rabbit pAb

A17536-100ul 100 ul
EUR 308

SRPK2 Rabbit pAb

A17536-200ul 200 ul
EUR 459

SRPK2 Rabbit pAb

A17536-20ul 20 ul
EUR 183

SRPK2 Rabbit pAb

A17536-50ul 50 ul
EUR 223

SRPK2 Antibody

46226-100ul 100ul
EUR 252

SRPK2 Antibody

46226-50ul 50ul
EUR 187

SRPK2 Antibody

DF9889 200ul
EUR 304
Description: SRPK2 Antibody detects endogenous levels of total SRPK2.

SRPK2 Antibody

1-CSB-PA022683LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SRPK2 Antibody

ABD13271 100 ug
EUR 438

SRPK2 Antibody

ABD9889 100 ug
EUR 438

SRPK2 Conjugated Antibody

C46226 100ul
EUR 397

Anti-SRPK2 antibody

STJ119628 100 µl
EUR 277

Anti-SRPK2 antibody

STJ191374 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SRPK2

SRPK2 siRNA

20-abx935179
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRPK2 siRNA

20-abx935180
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SRPK2

YF-PA14780 50 ug
EUR 363
Description: Mouse polyclonal to SRPK2

SRPK2 Antibody, HRP conjugated

1-CSB-PA022683LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SRPK2 Antibody, FITC conjugated

1-CSB-PA022683LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SRPK2 Antibody, Biotin conjugated

1-CSB-PA022683LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against SRPK2. Recognizes SRPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human)

4-PAH132Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2)

SRPK2 Blocking Peptide

DF9889-BP 1mg
EUR 195

SRPK2 cloning plasmid

CSB-CL022683HU1-10ug 10ug
EUR 688
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2067
  • Sequence: atgtcagttaactctgagaagtcgtcctcttcagaaaggccggagcctcaacagaaagctcctttagttcctcctcctccaccgccaccaccaccaccaccgccacctttgccagaccccacacccccggagccagaggaggagatcctgggatcagatgatgaggagcaagagg
  • Show more
Description: A cloning plasmid for the SRPK2 gene.

SRPK2 cloning plasmid

CSB-CL022683HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2067
  • Sequence: atgtcagttaactctgagaagtcgtcctcttcagaaaggccggagcctcaacagaaagctcctttagttcctcctcctccaccgccaccaccaccaccaccgccacctttgccagaccccacacccccggagccagaggaggagatcctgggatcagatgatgaggagcaagagg
  • Show more
Description: A cloning plasmid for the SRPK2 gene.

Mouse Serine/threonine- protein kinase SRPK2, Srpk2 ELISA KIT

ELI-52680m 96 Tests
EUR 865

Human Serine/threonine- protein kinase SRPK2, SRPK2 ELISA KIT

ELI-42502h 96 Tests
EUR 824

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), APC

4-PAH132Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with APC.

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), Biotinylated

4-PAH132Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with Biotin.

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), Cy3

4-PAH132Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with Cy3.

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), FITC

4-PAH132Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with FITC.

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), HRP

4-PAH132Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with HRP.

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), PE

4-PAH132Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with PE.

Mouse SRPK2 shRNA Plasmid

20-abx972893
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SRPK2 shRNA Plasmid

20-abx954600
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRSF Protein Kinase 2 (SRPK2) Antibody

20-abx218763
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

SRSF Protein Kinase 2 (SRPK2) Antibody

20-abx128040
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

SRSF Protein Kinase 2 (SRPK2) Polyclonal Antibody (Human), APC-Cy7

4-PAH132Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRPK2 (Glu380~Leu617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SRSF Protein Kinase 2 (SRPK2). This antibody is labeled with APC-Cy7.

Srpk2 ORF Vector (Rat) (pORF)

ORF077026 1.0 ug DNA
EUR 506

SRPK2 ORF Vector (Human) (pORF)

ORF010036 1.0 ug DNA
EUR 95

SRPK2 ORF Vector (Human) (pORF)

ORF010037 1.0 ug DNA
EUR 95

Srpk2 ORF Vector (Mouse) (pORF)

ORF058485 1.0 ug DNA
EUR 506

Srpk2 sgRNA CRISPR Lentivector set (Rat)

K7603401 3 x 1.0 ug
EUR 339

Srpk2 sgRNA CRISPR Lentivector set (Mouse)

K3767801 3 x 1.0 ug
EUR 339

SRPK2 sgRNA CRISPR Lentivector set (Human)

K2286901 3 x 1.0 ug
EUR 339

Recombinant SRSF Protein Kinase 2 (SRPK2)

4-RPH132Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78362
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.3kDa
  • Isoelectric Point: 4.6
Description: Recombinant Human SRSF Protein Kinase 2 expressed in: E.coli

Human SRSF Protein Kinase 2 (SRPK2) Protein

20-abx165866
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Srpk2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7603402 1.0 ug DNA
EUR 154

Srpk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7603403 1.0 ug DNA
EUR 154

Srpk2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7603404 1.0 ug DNA
EUR 154

Srpk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3767802 1.0 ug DNA
EUR 154

Srpk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3767803 1.0 ug DNA
EUR 154

Srpk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3767804 1.0 ug DNA
EUR 154

SRPK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2286902 1.0 ug DNA
EUR 154

SRPK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2286903 1.0 ug DNA
EUR 154

SRPK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2286904 1.0 ug DNA
EUR 154

SRPK2 Protein Vector (Rat) (pPB-C-His)

PV308102 500 ng
EUR 1166

SRPK2 Protein Vector (Rat) (pPB-N-His)

PV308103 500 ng
EUR 1166

SRPK2 Protein Vector (Rat) (pPM-C-HA)

PV308104 500 ng
EUR 1166

SRPK2 Protein Vector (Rat) (pPM-C-His)

PV308105 500 ng
EUR 1166

SRPK2 Protein Vector (Human) (pPB-C-His)

PV040141 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPB-N-His)

PV040142 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPM-C-HA)

PV040143 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPM-C-His)

PV040144 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPB-C-His)

PV040145 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPB-N-His)

PV040146 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPM-C-HA)

PV040147 500 ng
EUR 329

SRPK2 Protein Vector (Human) (pPM-C-His)

PV040148 500 ng
EUR 329

SRPK2 Protein Vector (Mouse) (pPB-C-His)

PV233938 500 ng
EUR 1065

SRPK2 Protein Vector (Mouse) (pPB-N-His)

PV233939 500 ng
EUR 1065

SRPK2 Protein Vector (Mouse) (pPM-C-HA)

PV233940 500 ng
EUR 1065

SRPK2 Protein Vector (Mouse) (pPM-C-His)

PV233941 500 ng
EUR 1065

Srpk2 3'UTR Luciferase Stable Cell Line

TU119698 1.0 ml Ask for price

Srpk2 3'UTR GFP Stable Cell Line

TU169698 1.0 ml Ask for price

Srpk2 3'UTR Luciferase Stable Cell Line

TU221183 1.0 ml Ask for price

SRPK2 3'UTR GFP Stable Cell Line

TU074612 1.0 ml
EUR 1394

Srpk2 3'UTR GFP Stable Cell Line

TU271183 1.0 ml Ask for price

SRPK2 3'UTR Luciferase Stable Cell Line

TU024612 1.0 ml
EUR 1394

SRPK2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715437 1.0 ug DNA
EUR 316

SRPK2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715441 1.0 ug DNA
EUR 316

SRPK2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715442 1.0 ug DNA
EUR 316

SRPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640075 1.0 ug DNA
EUR 1355

SRPK2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640079 1.0 ug DNA
EUR 1355

SRPK2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640080 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

SRPK2 Rabbit Polyclonal Antibody