STK31 Rabbit Polyclonal Antibody

STK31 Polyclonal Antibody

ABP60542-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530

STK31 Polyclonal Antibody

ABP60542-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530

STK31 Polyclonal Antibody

ABP60542-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530

STK31 Rabbit pAb

A13106-100ul 100 ul
EUR 308

STK31 Rabbit pAb

A13106-200ul 200 ul
EUR 459

STK31 Rabbit pAb

A13106-20ul 20 ul
EUR 183

STK31 Rabbit pAb

A13106-50ul 50 ul
EUR 223

STK31 Antibody

ABD9884 100 ug
EUR 438

STK31 antibody

70R-51391 100 ul
EUR 244
Description: Purified Polyclonal STK31 antibody

STK31 Antibody

46223-100ul 100ul
EUR 252

STK31 Antibody

46223-50ul 50ul
EUR 187

STK31 Antibody

DF9884 200ul
EUR 304
Description: STK31 Antibody detects endogenous levels of total STK31.

Polyclonal STK31 Antibody (C-term)

APR05864G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK31 (C-term). This antibody is tested and proven to work in the following applications:

STK31 Conjugated Antibody

C46223 100ul
EUR 397

anti- STK31 antibody

FNab08330 100µg
EUR 548.75
  • Immunogen: serine/threonine kinase 31
  • Uniprot ID: Q9BXU1
  • Gene ID: 56164
  • Research Area: Metabolism
Description: Antibody raised against STK31

Anti-STK31 antibody

PAab08330 100 ug
EUR 386

Anti-STK31 antibody

STJ115072 100 µl
EUR 277
Description: This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-STK31 antibody

STJ191360 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK31


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19980 50 ug
EUR 363
Description: Mouse polyclonal to STK31


YF-PA26417 50 ul
EUR 334
Description: Mouse polyclonal to STK31

STK31 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

STK31 cloning plasmid

CSB-CL861165HU-10ug 10ug
EUR 1098
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3060
  • Sequence: atgtgggtccagggtcactcttctagagcttccgcaacggaaagtgtgagtttttcaggaattgttcaaatggatgaagatacacattacgataaagtggaagatgtggttggaagtcacatagaagatgcagtaacattttgggcccagagtatcaatagaaataaggatatca
  • Show more
Description: A cloning plasmid for the STK31 gene.

STK31 Blocking Peptide

DF9884-BP 1mg
EUR 195

Anti-STK31 (1C10)

YF-MA18943 100 ug
EUR 363
Description: Mouse monoclonal to STK31

Mouse STK31 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF003309 96 Tests
EUR 689

Human STK31 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033259-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033259-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033260-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033260-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx238330-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

STK31 ORF Vector (Human) (pORF)

ORF033497 1.0 ug DNA
EUR 405

Stk31 ORF Vector (Mouse) (pORF)

ORF058691 1.0 ug DNA
EUR 506

Stk31 ORF Vector (Rat) (pORF)

ORF077156 1.0 ug DNA
EUR 506

pGL3-Basic-STK31 promoter Plasmid

PVTB80049-2a 2 ug
EUR 356

STK31 sgRNA CRISPR Lentivector set (Human)

K2303801 3 x 1.0 ug
EUR 339

Stk31 sgRNA CRISPR Lentivector set (Mouse)

K4467701 3 x 1.0 ug
EUR 339

Stk31 sgRNA CRISPR Lentivector set (Rat)

K6220601 3 x 1.0 ug
EUR 339

pGL3-Basic-STK31 Enhancer (WT) Plasmid

PVTB80049-2b 2 ug
EUR 356

STK31 sgRNA CRISPR Lentivector (Human) (Target 1)

K2303802 1.0 ug DNA
EUR 154

STK31 sgRNA CRISPR Lentivector (Human) (Target 2)

K2303803 1.0 ug DNA
EUR 154

STK31 sgRNA CRISPR Lentivector (Human) (Target 3)

K2303804 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4467702 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4467703 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4467704 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6220602 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6220603 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6220604 1.0 ug DNA
EUR 154

pGL3-Basic-STK31 Enhancer (WT)Reverse Plasmid

PVTB80049-2c 2 ug
EUR 356

STK31 Protein Vector (Human) (pPB-C-His)

PV133986 500 ng
EUR 811

STK31 Protein Vector (Human) (pPB-N-His)

PV133987 500 ng
EUR 811

STK31 Protein Vector (Human) (pPM-C-HA)

PV133988 500 ng
EUR 811

STK31 Protein Vector (Human) (pPM-C-His)

PV133989 500 ng
EUR 811

STK31 Protein Vector (Rat) (pPB-C-His)

PV308622 500 ng
EUR 1166

STK31 Protein Vector (Rat) (pPB-N-His)

PV308623 500 ng
EUR 1166

STK31 Protein Vector (Rat) (pPM-C-HA)

PV308624 500 ng
EUR 1166

STK31 Protein Vector (Rat) (pPM-C-His)

PV308625 500 ng
EUR 1166

STK31 Protein Vector (Mouse) (pPB-C-His)

PV234762 500 ng
EUR 1065

STK31 Protein Vector (Mouse) (pPB-N-His)

PV234763 500 ng
EUR 1065

STK31 Protein Vector (Mouse) (pPM-C-HA)

PV234764 500 ng
EUR 1065

STK31 Protein Vector (Mouse) (pPM-C-His)

PV234765 500 ng
EUR 1065

Stk31 3'UTR GFP Stable Cell Line

TU169849 1.0 ml Ask for price

Stk31 3'UTR Luciferase Stable Cell Line

TU119849 1.0 ml Ask for price

STK31 3'UTR GFP Stable Cell Line

TU074821 1.0 ml
EUR 2333

STK31 3'UTR Luciferase Stable Cell Line

TU024821 1.0 ml
EUR 2333

Stk31 3'UTR Luciferase Stable Cell Line

TU221315 1.0 ml Ask for price

Stk31 3'UTR GFP Stable Cell Line

TU271315 1.0 ml Ask for price

Human Serine/Threonine Kinase 31 (STK31) ELISA Kit

abx383523-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

STK31 Rabbit Polyclonal Antibody