Biocat Net

Amine biocat 3.0

STK31 Rabbit Polyclonal Antibody

STK31 Polyclonal Antibody

ABP60542-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530

STK31 Polyclonal Antibody

ES10202-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STK31 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK31 Polyclonal Antibody

ES10202-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK31 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK31 Rabbit pAb

A13106-100ul 100 ul
EUR 308

STK31 Rabbit pAb

A13106-200ul 200 ul
EUR 459

STK31 Rabbit pAb

A13106-20ul 20 ul
EUR 183

STK31 Rabbit pAb

A13106-50ul 50 ul
EUR 223

STK31 Antibody

46223-100ul 100ul
EUR 252

STK31 Antibody

46223-50ul 50ul
EUR 187

STK31 Antibody

DF9884 200ul
EUR 304
Description: STK31 Antibody detects endogenous levels of total STK31.

STK31 antibody

70R-51391 100 ul
EUR 244
Description: Purified Polyclonal STK31 antibody

STK31 Antibody

ABD9884 100 ug
EUR 438

Polyclonal STK31 Antibody (C-term)

APR05864G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK31 (C-term). This antibody is tested and proven to work in the following applications:

STK31 Conjugated Antibody

C46223 100ul
EUR 397

anti- STK31 antibody

FNab08330 100µg
EUR 548.75
  • Immunogen: serine/threonine kinase 31
  • Uniprot ID: Q9BXU1
  • Gene ID: 56164
  • Research Area: Metabolism
Description: Antibody raised against STK31

Anti-STK31 antibody

PAab08330 100 ug
EUR 386

Anti-STK31 antibody

STJ115072 100 µl
EUR 277
Description: This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-STK31 antibody

STJ191360 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK31

STK31 siRNA

20-abx935469
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STK31 siRNA

20-abx935470
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-STK31

YF-PA19980 50 ug
EUR 363
Description: Mouse polyclonal to STK31

anti-STK31

YF-PA26417 50 ul
EUR 334
Description: Mouse polyclonal to STK31

STK31 Blocking Peptide

DF9884-BP 1mg
EUR 195

STK31 Blocking Peptide

20-abx064266
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

STK31 cloning plasmid

CSB-CL861165HU-10ug 10ug
EUR 1098
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3060
  • Sequence: atgtgggtccagggtcactcttctagagcttccgcaacggaaagtgtgagtttttcaggaattgttcaaatggatgaagatacacattacgataaagtggaagatgtggttggaagtcacatagaagatgcagtaacattttgggcccagagtatcaatagaaataaggatatca
  • Show more
Description: A cloning plasmid for the STK31 gene.

Anti-STK31 (1C10)

YF-MA18943 100 ug
EUR 363
Description: Mouse monoclonal to STK31

STK31 ELISA KIT|Human

EF003309 96 Tests
EUR 689

Mouse STK31 shRNA Plasmid

20-abx978784
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STK31 shRNA Plasmid

20-abx961099
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

20-abx007767
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

20-abx218802
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

20-abx124137
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033259-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033259-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033260-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx033260-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 31 (STK31) Antibody

abx238330-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stk31 ORF Vector (Rat) (pORF)

ORF077156 1.0 ug DNA
EUR 506

STK31 ORF Vector (Human) (pORF)

ORF033497 1.0 ug DNA
EUR 405

Stk31 ORF Vector (Mouse) (pORF)

ORF058691 1.0 ug DNA
EUR 506

pGL3-Basic-STK31 promoter Plasmid

PVTB80049-2a 2 ug
EUR 356

Stk31 sgRNA CRISPR Lentivector set (Rat)

K6220601 3 x 1.0 ug
EUR 339

Stk31 sgRNA CRISPR Lentivector set (Mouse)

K4467701 3 x 1.0 ug
EUR 339

STK31 sgRNA CRISPR Lentivector set (Human)

K2303801 3 x 1.0 ug
EUR 339

pGL3-Basic-STK31 Enhancer (WT) Plasmid

PVTB80049-2b 2 ug
EUR 356

Stk31 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6220602 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6220603 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6220604 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4467702 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4467703 1.0 ug DNA
EUR 154

Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4467704 1.0 ug DNA
EUR 154

STK31 sgRNA CRISPR Lentivector (Human) (Target 1)

K2303802 1.0 ug DNA
EUR 154

STK31 sgRNA CRISPR Lentivector (Human) (Target 2)

K2303803 1.0 ug DNA
EUR 154

STK31 sgRNA CRISPR Lentivector (Human) (Target 3)

K2303804 1.0 ug DNA
EUR 154

STK31 Protein Vector (Human) (pPB-C-His)

PV133986 500 ng
EUR 811

STK31 Protein Vector (Human) (pPB-N-His)

PV133987 500 ng
EUR 811

STK31 Protein Vector (Human) (pPM-C-HA)

PV133988 500 ng
EUR 811

STK31 Protein Vector (Human) (pPM-C-His)

PV133989 500 ng
EUR 811

STK31 Protein Vector (Rat) (pPB-C-His)

PV308622 500 ng
EUR 1166

STK31 Protein Vector (Rat) (pPB-N-His)

PV308623 500 ng
EUR 1166

STK31 Protein Vector (Rat) (pPM-C-HA)

PV308624 500 ng
EUR 1166

STK31 Protein Vector (Rat) (pPM-C-His)

PV308625 500 ng
EUR 1166

STK31 Protein Vector (Mouse) (pPB-C-His)

PV234762 500 ng
EUR 1065

STK31 Protein Vector (Mouse) (pPB-N-His)

PV234763 500 ng
EUR 1065

STK31 Protein Vector (Mouse) (pPM-C-HA)

PV234764 500 ng
EUR 1065

STK31 Protein Vector (Mouse) (pPM-C-His)

PV234765 500 ng
EUR 1065

pGL3-Basic-STK31 Enhancer (WT)Reverse Plasmid

PVTB80049-2c 2 ug
EUR 356

Stk31 3'UTR Luciferase Stable Cell Line

TU119849 1.0 ml Ask for price

Stk31 3'UTR GFP Stable Cell Line

TU169849 1.0 ml Ask for price

Stk31 3'UTR Luciferase Stable Cell Line

TU221315 1.0 ml Ask for price

STK31 3'UTR GFP Stable Cell Line

TU074821 1.0 ml
EUR 2333

Stk31 3'UTR GFP Stable Cell Line

TU271315 1.0 ml Ask for price

STK31 3'UTR Luciferase Stable Cell Line

TU024821 1.0 ml
EUR 2333

Human Serine/Threonine Kinase 31 (STK31) ELISA Kit

abx383523-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

STK31 Rabbit Polyclonal Antibody