STK31 Polyclonal Antibody |
ABP60542-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
- Applications tips:
|
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530 |
STK31 Polyclonal Antibody |
ABP60542-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
- Applications tips:
|
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530 |
STK31 Polyclonal Antibody |
ABP60542-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
- Applications tips:
|
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530 |
STK31 Rabbit pAb |
A13106-100ul |
Abclonal |
100 ul |
EUR 308 |
STK31 Rabbit pAb |
A13106-200ul |
Abclonal |
200 ul |
EUR 459 |
STK31 Rabbit pAb |
A13106-20ul |
Abclonal |
20 ul |
EUR 183 |
STK31 Rabbit pAb |
A13106-50ul |
Abclonal |
50 ul |
EUR 223 |
STK31 antibody |
70R-51391 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal STK31 antibody |
STK31 Antibody |
46223-100ul |
SAB |
100ul |
EUR 252 |
STK31 Antibody |
46223-50ul |
SAB |
50ul |
EUR 187 |
STK31 Antibody |
DF9884 |
Affbiotech |
200ul |
EUR 304 |
Description: STK31 Antibody detects endogenous levels of total STK31. |
Polyclonal STK31 Antibody (C-term) |
APR05864G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK31 (C-term). This antibody is tested and proven to work in the following applications: |
STK31 Conjugated Antibody |
C46223 |
SAB |
100ul |
EUR 397 |
anti- STK31 antibody |
FNab08330 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: serine/threonine kinase 31
- Uniprot ID: Q9BXU1
- Gene ID: 56164
- Research Area: Metabolism
|
Description: Antibody raised against STK31 |
Anti-STK31 antibody |
STJ115072 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-STK31 antibody |
STJ191360 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STK31 |
STK31 siRNA |
20-abx935469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK31 siRNA |
20-abx935470 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-STK31 |
YF-PA19980 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to STK31 |
anti-STK31 |
YF-PA26417 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to STK31 |
STK31 Blocking Peptide |
20-abx064266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK31 cloning plasmid |
CSB-CL861165HU-10ug |
Cusabio |
10ug |
EUR 1098 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3060
- Sequence: atgtgggtccagggtcactcttctagagcttccgcaacggaaagtgtgagtttttcaggaattgttcaaatggatgaagatacacattacgataaagtggaagatgtggttggaagtcacatagaagatgcagtaacattttgggcccagagtatcaatagaaataaggatatca
- Show more
|
Description: A cloning plasmid for the STK31 gene. |
STK31 Blocking Peptide |
DF9884-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-STK31 (1C10) |
YF-MA18943 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK31 |
Mouse STK31 shRNA Plasmid |
20-abx978784 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STK31 shRNA Plasmid |
20-abx961099 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
20-abx124137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
abx033259-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
abx033259-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
abx033260-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
abx033260-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
20-abx007767 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
20-abx218802 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
abx238330-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
STK31 ORF Vector (Human) (pORF) |
ORF033497 |
ABM |
1.0 ug DNA |
EUR 405 |
Stk31 ORF Vector (Mouse) (pORF) |
ORF058691 |
ABM |
1.0 ug DNA |
EUR 506 |
Stk31 ORF Vector (Rat) (pORF) |
ORF077156 |
ABM |
1.0 ug DNA |
EUR 506 |
STK31 sgRNA CRISPR Lentivector set (Human) |
K2303801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk31 sgRNA CRISPR Lentivector set (Mouse) |
K4467701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk31 sgRNA CRISPR Lentivector set (Rat) |
K6220601 |
ABM |
3 x 1.0 ug |
EUR 339 |
STK31 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2303802 |
ABM |
1.0 ug DNA |
EUR 154 |
STK31 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2303803 |
ABM |
1.0 ug DNA |
EUR 154 |
STK31 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2303804 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4467702 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4467703 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4467704 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk31 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6220602 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk31 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6220603 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk31 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6220604 |
ABM |
1.0 ug DNA |
EUR 154 |
pGL3-Basic-STK31 Enhancer (WT)Reverse Plasmid |
PVTB80049-2c |
Lifescience Market |
2 ug |
EUR 356 |
STK31 Protein Vector (Human) (pPB-C-His) |
PV133986 |
ABM |
500 ng |
EUR 811 |
STK31 Protein Vector (Human) (pPB-N-His) |
PV133987 |
ABM |
500 ng |
EUR 811 |
STK31 Protein Vector (Human) (pPM-C-HA) |
PV133988 |
ABM |
500 ng |
EUR 811 |
STK31 Protein Vector (Human) (pPM-C-His) |
PV133989 |
ABM |
500 ng |
EUR 811 |
STK31 Protein Vector (Rat) (pPB-C-His) |
PV308622 |
ABM |
500 ng |
EUR 1166 |
STK31 Protein Vector (Rat) (pPB-N-His) |
PV308623 |
ABM |
500 ng |
EUR 1166 |
STK31 Protein Vector (Rat) (pPM-C-HA) |
PV308624 |
ABM |
500 ng |
EUR 1166 |
STK31 Protein Vector (Rat) (pPM-C-His) |
PV308625 |
ABM |
500 ng |
EUR 1166 |
STK31 Protein Vector (Mouse) (pPB-C-His) |
PV234762 |
ABM |
500 ng |
EUR 1065 |
STK31 Protein Vector (Mouse) (pPB-N-His) |
PV234763 |
ABM |
500 ng |
EUR 1065 |
STK31 Protein Vector (Mouse) (pPM-C-HA) |
PV234764 |
ABM |
500 ng |
EUR 1065 |
STK31 Protein Vector (Mouse) (pPM-C-His) |
PV234765 |
ABM |
500 ng |
EUR 1065 |
Stk31 3'UTR GFP Stable Cell Line |
TU169849 |
ABM |
1.0 ml |
Ask for price |
Stk31 3'UTR Luciferase Stable Cell Line |
TU119849 |
ABM |
1.0 ml |
Ask for price |
STK31 3'UTR GFP Stable Cell Line |
TU074821 |
ABM |
1.0 ml |
EUR 2333 |
STK31 3'UTR Luciferase Stable Cell Line |
TU024821 |
ABM |
1.0 ml |
EUR 2333 |
Stk31 3'UTR Luciferase Stable Cell Line |
TU221315 |
ABM |
1.0 ml |
Ask for price |
Stk31 3'UTR GFP Stable Cell Line |
TU271315 |
ABM |
1.0 ml |
Ask for price |
Human Serine/Threonine Kinase 31 (STK31) ELISA Kit |
abx383523-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
STK31 Rabbit Polyclonal Antibody