 STK31 Polyclonal Antibody |
|
ABP60542-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530
- Applications tips:
|
|
Description: A polyclonal antibody for detection of STK31 from Human. This STK31 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK31 protein at amino acid sequence of 450-530 |
STK31 Polyclonal Antibody |
|
ES10202-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against STK31 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STK31 Polyclonal Antibody |
|
ES10202-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against STK31 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 STK31 Rabbit pAb |
|
A13106-100ul |
Abclonal |
100 ul |
EUR 308 |
STK31 Rabbit pAb |
|
A13106-200ul |
Abclonal |
200 ul |
EUR 459 |
STK31 Rabbit pAb |
|
A13106-20ul |
Abclonal |
20 ul |
EUR 183 |
STK31 Rabbit pAb |
|
A13106-50ul |
Abclonal |
50 ul |
EUR 223 |
 STK31 Antibody |
|
46223-100ul |
SAB |
100ul |
EUR 252 |
STK31 Antibody |
|
46223-50ul |
SAB |
50ul |
EUR 187 |
STK31 Antibody |
|
DF9884 |
Affbiotech |
200ul |
EUR 304 |
|
Description: STK31 Antibody detects endogenous levels of total STK31. |
 STK31 antibody |
|
70R-51391 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal STK31 antibody |
) Polyclonal STK31 Antibody (C-term) |
|
APR05864G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK31 (C-term). This antibody is tested and proven to work in the following applications: |
 STK31 Conjugated Antibody |
|
C46223 |
SAB |
100ul |
EUR 397 |
 anti- STK31 antibody |
|
FNab08330 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: serine/threonine kinase 31
- Uniprot ID: Q9BXU1
- Gene ID: 56164
- Research Area: Metabolism
|
|
Description: Antibody raised against STK31 |
 Anti-STK31 antibody |
|
STJ115072 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-STK31 antibody |
|
STJ191360 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to STK31 |
 STK31 siRNA |
|
20-abx935469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK31 siRNA |
|
20-abx935470 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-STK31 |
|
YF-PA19980 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to STK31 |
anti-STK31 |
|
YF-PA26417 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to STK31 |
 STK31 Blocking Peptide |
|
DF9884-BP |
Affbiotech |
1mg |
EUR 195 |
STK31 Blocking Peptide |
|
20-abx064266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 STK31 cloning plasmid |
|
CSB-CL861165HU-10ug |
Cusabio |
10ug |
EUR 1098 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3060
- Sequence: atgtgggtccagggtcactcttctagagcttccgcaacggaaagtgtgagtttttcaggaattgttcaaatggatgaagatacacattacgataaagtggaagatgtggttggaagtcacatagaagatgcagtaacattttgggcccagagtatcaatagaaataaggatatca
- Show more
|
|
Description: A cloning plasmid for the STK31 gene. |
) Anti-STK31 (1C10) |
|
YF-MA18943 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to STK31 |
 Mouse STK31 shRNA Plasmid |
|
20-abx978784 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human STK31 shRNA Plasmid |
|
20-abx961099 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Serine/Threonine Kinase 31 (STK31) Antibody |
|
20-abx007767 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
20-abx218802 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
20-abx124137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
abx033259-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
abx033259-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
abx033260-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
abx033260-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 31 (STK31) Antibody |
|
abx238330-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (pORF)) Stk31 ORF Vector (Rat) (pORF) |
|
ORF077156 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) STK31 ORF Vector (Human) (pORF) |
|
ORF033497 |
ABM |
1.0 ug DNA |
EUR 405 |
 (pORF)) Stk31 ORF Vector (Mouse) (pORF) |
|
ORF058691 |
ABM |
1.0 ug DNA |
EUR 506 |
) Stk31 sgRNA CRISPR Lentivector set (Rat) |
|
K6220601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Stk31 sgRNA CRISPR Lentivector set (Mouse) |
|
K4467701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) STK31 sgRNA CRISPR Lentivector set (Human) |
|
K2303801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Stk31 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6220602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Stk31 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6220603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Stk31 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6220604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4467702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4467703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Stk31 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4467704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) STK31 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2303802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) STK31 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2303803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) STK31 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2303804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) STK31 Protein Vector (Human) (pPB-C-His) |
|
PV133986 |
ABM |
500 ng |
EUR 811 |
 (pPB-N-His)) STK31 Protein Vector (Human) (pPB-N-His) |
|
PV133987 |
ABM |
500 ng |
EUR 811 |
 (pPM-C-HA)) STK31 Protein Vector (Human) (pPM-C-HA) |
|
PV133988 |
ABM |
500 ng |
EUR 811 |
 (pPM-C-His)) STK31 Protein Vector (Human) (pPM-C-His) |
|
PV133989 |
ABM |
500 ng |
EUR 811 |
 (pPB-C-His)) STK31 Protein Vector (Rat) (pPB-C-His) |
|
PV308622 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) STK31 Protein Vector (Rat) (pPB-N-His) |
|
PV308623 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) STK31 Protein Vector (Rat) (pPM-C-HA) |
|
PV308624 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) STK31 Protein Vector (Rat) (pPM-C-His) |
|
PV308625 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) STK31 Protein Vector (Mouse) (pPB-C-His) |
|
PV234762 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) STK31 Protein Vector (Mouse) (pPB-N-His) |
|
PV234763 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) STK31 Protein Vector (Mouse) (pPM-C-HA) |
|
PV234764 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) STK31 Protein Vector (Mouse) (pPM-C-His) |
|
PV234765 |
ABM |
500 ng |
EUR 1065 |
Reverse Plasmid) pGL3-Basic-STK31 Enhancer (WT)Reverse Plasmid |
|
PVTB80049-2c |
Lifescience Market |
2 ug |
EUR 356 |
 Stk31 3'UTR Luciferase Stable Cell Line |
|
TU119849 |
ABM |
1.0 ml |
Ask for price |
 Stk31 3'UTR GFP Stable Cell Line |
|
TU169849 |
ABM |
1.0 ml |
Ask for price |
Stk31 3'UTR Luciferase Stable Cell Line |
|
TU221315 |
ABM |
1.0 ml |
Ask for price |
 STK31 3'UTR GFP Stable Cell Line |
|
TU074821 |
ABM |
1.0 ml |
EUR 2333 |
Stk31 3'UTR GFP Stable Cell Line |
|
TU271315 |
ABM |
1.0 ml |
Ask for price |
 STK31 3'UTR Luciferase Stable Cell Line |
|
TU024821 |
ABM |
1.0 ml |
EUR 2333 |
 ELISA Kit) Human Serine/Threonine Kinase 31 (STK31) ELISA Kit |
|
abx383523-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
STK31 Rabbit Polyclonal Antibody
 Plasmid)