STK38 Rabbit Polyclonal Antibody

STK38 Polyclonal Antibody

ABP60543-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470

STK38 Polyclonal Antibody

ABP60543-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470

STK38 Polyclonal Antibody

ABP60543-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470

STK38 Polyclonal Antibody

ABP60544-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300

STK38 Polyclonal Antibody

ABP60544-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300

STK38 Polyclonal Antibody

ABP60544-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300

STK38 Polyclonal Antibody

31463-100ul 100ul
EUR 252

STK38 Polyclonal Antibody

31463-50ul 50ul
EUR 187

STK38 Rabbit pAb

A8191-100ul 100 ul
EUR 308

STK38 Rabbit pAb

A8191-200ul 200 ul
EUR 459

STK38 Rabbit pAb

A8191-20ul 20 ul
EUR 183

STK38 Rabbit pAb

A8191-50ul 50 ul
EUR 223

Polyclonal STK38 Antibody (Internal)

APG01192G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human STK38 (Internal). This antibody is tested and proven to work in the following applications:

STK38 Polyclonal Conjugated Antibody

C31463 100ul
EUR 397

STK38 antibody

70R-5769 50 ug
EUR 467
Description: Rabbit polyclonal STK38 antibody raised against the C terminal of STK38

STK38 antibody

70R-20601 50 ul
EUR 435
Description: Rabbit polyclonal STK38 antibody

STK38 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STK38. Recognizes STK38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STK38 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STK38. Recognizes STK38 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Mouse Stk38 Antibody (C-term)

APR04403G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Stk38 (C-term). This antibody is tested and proven to work in the following applications:

anti- STK38 antibody

FNab08336 100µg
EUR 585
  • Immunogen: serine/threonine kinase 38
  • Uniprot ID: Q15208
  • Gene ID: 11329
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK38

anti- STK38 antibody

FNab08337 100µg
EUR 585
  • Immunogen: serine/threonine kinase 38
  • Uniprot ID: Q15208
  • Gene ID: 11329
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK38

Anti-STK38 antibody

PAab08336 100 ug
EUR 412

Anti-STK38 antibody

PAab08337 100 ug
EUR 412

Anti-STK38 antibody

STJ110490 100 µl
EUR 277
Description: This gene encodes a member of the AGC serine/threonine kinase family of proteins. The kinase activity of this protein is regulated by autophosphorylation and phosphorylation by other upstream kinases. This protein has been shown to function in the cell cycle and apoptosis. This protein has also been found to regulate the protein stability and transcriptional activity of the MYC oncogene. Alternative splicing results in multiple transcript variants.

Anti-STK38 antibody

STJ190112 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK38

Anti-STK38 antibody

STJ191362 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK38


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17594 100 ug
EUR 403
Description: Rabbit polyclonal to STK38


YF-PA25788 50 ul
EUR 334
Description: Mouse polyclonal to STK38

Polyclonal NDR1 / STK38 Antibody (C-Term, near)

APG00748G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDR1 / STK38 (C-Term, near). This antibody is tested and proven to work in the following applications:

Anti-NDR1 / STK38 antibody

STJ72524 100 µg
EUR 359

Polyclonal NDR1 / STK38 (aa362-377) Antibody (internal region)

APG00749G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDR1 / STK38 (aa362-377) (internal region). This antibody is tested and proven to work in the following applications:

STK38 cloning plasmid

CSB-CL614885HU-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atggcaatgacaggctcaacaccttgctcatccatgagtaaccacacaaaggaaagggtgacaatgaccaaagtgacactggagaatttttatagcaaccttatcgctcaacatgaagaacgagaaatgagacaaaagaagttagaaaaggtgatggaagaagaaggcctaaaag
  • Show more
Description: A cloning plasmid for the STK38 gene.

STK38 Blocking Peptide

33R-3966 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STK38 antibody, catalog no. 70R-5769

Anti-STK38 (2F3)

YF-MA17716 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (6G11)

YF-MA17717 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2F6)

YF-MA17718 200 ul
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (3A5)

YF-MA11363 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (6F1)

YF-MA11364 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2F6)

YF-MA11365 50 ug
EUR 363
Description: Mouse monoclonal to STK38

Mouse STK38 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF003316 96 Tests
EUR 689

Human STK38 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK38 Recombinant Protein (Human)

RP030433 100 ug Ask for price

STK38 Recombinant Protein (Rat)

RP231482 100 ug Ask for price

STK38 Recombinant Protein (Mouse)

RP176096 100 ug Ask for price

Anti-STK38 (2G8-1F3)

YF-MA17715 200 ul
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2G8-1F3)

YF-MA11362 50 ug
EUR 363
Description: Mouse monoclonal to STK38

Serine/Threonine Kinase 38 (STK38) Antibody

abx145679-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 38 (STK38) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 38 (STK38) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 38 (STK38) Antibody

abx238336-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Serine/Threonine Kinase 38 (STK38) Antibody

abx238337-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Monoclonal STK38 Antibody (clone 6F1), Clone: 6F1

AMM02099G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human STK38 (clone 6F1). The antibodies are raised in Mouse and are from clone 6F1. This antibody is applicable in WB and IHC-P, E

Monoclonal STK38 Antibody (monoclonal) (M01), Clone: S5

AMM04149G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human STK38 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone S5. This antibody is applicable in WB, IHC and IF, IP

Monoclonal STK38 Antibody (monoclonal) (M11), Clone: 2F6

AMM04150G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human STK38 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 2F6. This antibody is applicable in WB, IHC and IF, E

h STK38 inducible lentiviral particles

LVP249 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK38, is fully sequence verified and matched to NCBI accession ID: NM_007271

Stk38 ORF Vector (Mouse) (pORF)

ORF058700 1.0 ug DNA
EUR 506

STK38 ORF Vector (Human) (pORF)

ORF010145 1.0 ug DNA
EUR 95

Stk38 ORF Vector (Rat) (pORF)

ORF077162 1.0 ug DNA
EUR 506

STK38 sgRNA CRISPR Lentivector set (Human)

K2304601 3 x 1.0 ug
EUR 339

Stk38 sgRNA CRISPR Lentivector set (Rat)

K7236901 3 x 1.0 ug
EUR 339

Stk38 sgRNA CRISPR Lentivector set (Mouse)

K4966501 3 x 1.0 ug
EUR 339

STK38 sgRNA CRISPR Lentivector (Human) (Target 1)

K2304602 1.0 ug DNA
EUR 154

STK38 sgRNA CRISPR Lentivector (Human) (Target 2)

K2304603 1.0 ug DNA
EUR 154

STK38 sgRNA CRISPR Lentivector (Human) (Target 3)

K2304604 1.0 ug DNA
EUR 154

Stk38 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7236902 1.0 ug DNA
EUR 154

Stk38 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7236903 1.0 ug DNA
EUR 154

Stk38 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7236904 1.0 ug DNA
EUR 154

Stk38 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4966502 1.0 ug DNA
EUR 154

Stk38 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4966503 1.0 ug DNA
EUR 154

Stk38 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4966504 1.0 ug DNA
EUR 154

STK38 Protein Vector (Human) (pPB-C-His)

PV040577 500 ng
EUR 329

STK38 Protein Vector (Human) (pPB-N-His)

PV040578 500 ng
EUR 329

STK38 Protein Vector (Human) (pPM-C-HA)

PV040579 500 ng
EUR 329

STK38 Protein Vector (Human) (pPM-C-His)

PV040580 500 ng
EUR 329

STK38 Protein Vector (Rat) (pPB-C-His)

PV308646 500 ng
EUR 603

STK38 Protein Vector (Rat) (pPB-N-His)

PV308647 500 ng
EUR 603

STK38 Protein Vector (Rat) (pPM-C-HA)

PV308648 500 ng
EUR 603

STK38 Protein Vector (Rat) (pPM-C-His)

PV308649 500 ng
EUR 603

STK38 Protein Vector (Mouse) (pPB-C-His)

PV234798 500 ng
EUR 603

STK38 Protein Vector (Mouse) (pPB-N-His)

PV234799 500 ng
EUR 603

STK38 Protein Vector (Mouse) (pPM-C-HA)

PV234800 500 ng
EUR 603

STK38 Protein Vector (Mouse) (pPM-C-His)

PV234801 500 ng
EUR 603

Stk38 3'UTR GFP Stable Cell Line

TU169856 1.0 ml Ask for price

Stk38 3'UTR Luciferase Stable Cell Line

TU119856 1.0 ml Ask for price

STK38 3'UTR GFP Stable Cell Line

TU074829 1.0 ml
EUR 1521

STK38 3'UTR Luciferase Stable Cell Line

TU024829 1.0 ml
EUR 1521

Stk38 3'UTR Luciferase Stable Cell Line

TU221322 1.0 ml Ask for price

Stk38 3'UTR GFP Stable Cell Line

TU271322 1.0 ml Ask for price

Human Serine/Threonine Kinase 38 (STK38) ELISA Kit

abx383529-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

STK38 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV630169 1.0 ug DNA
EUR 514

STK38 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV630173 1.0 ug DNA
EUR 514

STK38 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV630174 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

STK38 Rabbit Polyclonal Antibody