STK38 Polyclonal Antibody |
ABP60543-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
- Applications tips:
|
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470 |
STK38 Polyclonal Antibody |
ABP60543-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
- Applications tips:
|
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470 |
STK38 Polyclonal Antibody |
ABP60543-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
- Applications tips:
|
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470 |
STK38 Polyclonal Antibody |
ABP60544-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300 |
STK38 Polyclonal Antibody |
ABP60544-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300 |
STK38 Polyclonal Antibody |
ABP60544-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300 |
STK38 Polyclonal Antibody |
31463-100ul |
SAB |
100ul |
EUR 252 |
STK38 Polyclonal Antibody |
31463-50ul |
SAB |
50ul |
EUR 187 |
STK38 Rabbit pAb |
A8191-100ul |
Abclonal |
100 ul |
EUR 308 |
STK38 Rabbit pAb |
A8191-200ul |
Abclonal |
200 ul |
EUR 459 |
STK38 Rabbit pAb |
A8191-20ul |
Abclonal |
20 ul |
EUR 183 |
STK38 Rabbit pAb |
A8191-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal STK38 Antibody (Internal) |
APG01192G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human STK38 (Internal). This antibody is tested and proven to work in the following applications: |
STK38 Polyclonal Conjugated Antibody |
C31463 |
SAB |
100ul |
EUR 397 |
STK38 antibody |
70R-5769 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal STK38 antibody raised against the C terminal of STK38 |
STK38 antibody |
70R-20601 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal STK38 antibody |
STK38 Antibody |
1-CSB-PA614885ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against STK38. Recognizes STK38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STK38 Antibody |
1-CSB-PA022852GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against STK38. Recognizes STK38 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal Mouse Stk38 Antibody (C-term) |
APR04403G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Stk38 (C-term). This antibody is tested and proven to work in the following applications: |
anti- STK38 antibody |
FNab08336 |
FN Test |
100µg |
EUR 585 |
- Immunogen: serine/threonine kinase 38
- Uniprot ID: Q15208
- Gene ID: 11329
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against STK38 |
anti- STK38 antibody |
FNab08337 |
FN Test |
100µg |
EUR 585 |
- Immunogen: serine/threonine kinase 38
- Uniprot ID: Q15208
- Gene ID: 11329
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against STK38 |
Anti-STK38 antibody |
STJ110490 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the AGC serine/threonine kinase family of proteins. The kinase activity of this protein is regulated by autophosphorylation and phosphorylation by other upstream kinases. This protein has been shown to function in the cell cycle and apoptosis. This protein has also been found to regulate the protein stability and transcriptional activity of the MYC oncogene. Alternative splicing results in multiple transcript variants. |
Anti-STK38 antibody |
STJ190112 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STK38 |
Anti-STK38 antibody |
STJ191362 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STK38 |
STK38 siRNA |
20-abx935485 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK38 siRNA |
20-abx935486 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-STK38 |
YF-PA17594 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to STK38 |
anti-STK38 |
YF-PA25788 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to STK38 |
Polyclonal NDR1 / STK38 Antibody (C-Term, near) |
APG00748G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDR1 / STK38 (C-Term, near). This antibody is tested and proven to work in the following applications: |
Polyclonal NDR1 / STK38 (aa362-377) Antibody (internal region) |
APG00749G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDR1 / STK38 (aa362-377) (internal region). This antibody is tested and proven to work in the following applications: |
STK38 cloning plasmid |
CSB-CL614885HU-10ug |
Cusabio |
10ug |
EUR 502 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1398
- Sequence: atggcaatgacaggctcaacaccttgctcatccatgagtaaccacacaaaggaaagggtgacaatgaccaaagtgacactggagaatttttatagcaaccttatcgctcaacatgaagaacgagaaatgagacaaaagaagttagaaaaggtgatggaagaagaaggcctaaaag
- Show more
|
Description: A cloning plasmid for the STK38 gene. |
STK38 Blocking Peptide |
33R-3966 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STK38 antibody, catalog no. 70R-5769 |
Anti-STK38 (2F3) |
YF-MA17716 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Anti-STK38 (6G11) |
YF-MA17717 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Anti-STK38 (2F6) |
YF-MA17718 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Anti-STK38 (3A5) |
YF-MA11363 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Anti-STK38 (6F1) |
YF-MA11364 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Anti-STK38 (2F6) |
YF-MA11365 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Mouse STK38 shRNA Plasmid |
20-abx979744 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STK38 shRNA Plasmid |
20-abx957756 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STK38 Recombinant Protein (Human) |
RP030433 |
ABM |
100 ug |
Ask for price |
STK38 Recombinant Protein (Rat) |
RP231482 |
ABM |
100 ug |
Ask for price |
STK38 Recombinant Protein (Mouse) |
RP176096 |
ABM |
100 ug |
Ask for price |
Anti-STK38 (2G8-1F3) |
YF-MA17715 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Anti-STK38 (2G8-1F3) |
YF-MA11362 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to STK38 |
Serine/Threonine Kinase 38 (STK38) Antibody |
abx145679-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 38 (STK38) Antibody |
20-abx005900 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 38 (STK38) Antibody |
20-abx320543 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 38 (STK38) Antibody |
abx238336-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Serine/Threonine Kinase 38 (STK38) Antibody |
abx238337-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Monoclonal STK38 Antibody (clone 6F1), Clone: 6F1 |
AMM02099G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human STK38 (clone 6F1). The antibodies are raised in Mouse and are from clone 6F1. This antibody is applicable in WB and IHC-P, E |
Monoclonal STK38 Antibody (monoclonal) (M01), Clone: S5 |
AMM04149G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human STK38 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone S5. This antibody is applicable in WB, IHC and IF, IP |
Monoclonal STK38 Antibody (monoclonal) (M11), Clone: 2F6 |
AMM04150G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human STK38 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 2F6. This antibody is applicable in WB, IHC and IF, E |
h STK38 inducible lentiviral particles |
LVP249 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK38, is fully sequence verified and matched to NCBI accession ID: NM_007271 |
Stk38 ORF Vector (Mouse) (pORF) |
ORF058700 |
ABM |
1.0 ug DNA |
EUR 506 |
STK38 ORF Vector (Human) (pORF) |
ORF010145 |
ABM |
1.0 ug DNA |
EUR 95 |
Stk38 ORF Vector (Rat) (pORF) |
ORF077162 |
ABM |
1.0 ug DNA |
EUR 506 |
STK38 sgRNA CRISPR Lentivector set (Human) |
K2304601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk38 sgRNA CRISPR Lentivector set (Rat) |
K7236901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk38 sgRNA CRISPR Lentivector set (Mouse) |
K4966501 |
ABM |
3 x 1.0 ug |
EUR 339 |
STK38 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2304602 |
ABM |
1.0 ug DNA |
EUR 154 |
STK38 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2304603 |
ABM |
1.0 ug DNA |
EUR 154 |
STK38 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2304604 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk38 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7236902 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk38 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7236903 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk38 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7236904 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk38 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4966502 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk38 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4966503 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk38 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4966504 |
ABM |
1.0 ug DNA |
EUR 154 |
STK38 Protein Vector (Human) (pPB-C-His) |
PV040577 |
ABM |
500 ng |
EUR 329 |
STK38 Protein Vector (Human) (pPB-N-His) |
PV040578 |
ABM |
500 ng |
EUR 329 |
STK38 Protein Vector (Human) (pPM-C-HA) |
PV040579 |
ABM |
500 ng |
EUR 329 |
STK38 Protein Vector (Human) (pPM-C-His) |
PV040580 |
ABM |
500 ng |
EUR 329 |
STK38 Protein Vector (Rat) (pPB-C-His) |
PV308646 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Rat) (pPB-N-His) |
PV308647 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Rat) (pPM-C-HA) |
PV308648 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Rat) (pPM-C-His) |
PV308649 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Mouse) (pPB-C-His) |
PV234798 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Mouse) (pPB-N-His) |
PV234799 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Mouse) (pPM-C-HA) |
PV234800 |
ABM |
500 ng |
EUR 603 |
STK38 Protein Vector (Mouse) (pPM-C-His) |
PV234801 |
ABM |
500 ng |
EUR 603 |
Stk38 3'UTR GFP Stable Cell Line |
TU169856 |
ABM |
1.0 ml |
Ask for price |
Stk38 3'UTR Luciferase Stable Cell Line |
TU119856 |
ABM |
1.0 ml |
Ask for price |
STK38 3'UTR GFP Stable Cell Line |
TU074829 |
ABM |
1.0 ml |
EUR 1521 |
STK38 3'UTR Luciferase Stable Cell Line |
TU024829 |
ABM |
1.0 ml |
EUR 1521 |
Stk38 3'UTR Luciferase Stable Cell Line |
TU221322 |
ABM |
1.0 ml |
Ask for price |
Stk38 3'UTR GFP Stable Cell Line |
TU271322 |
ABM |
1.0 ml |
Ask for price |
Human Serine/Threonine Kinase 38 (STK38) ELISA Kit |
abx383529-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
STK38 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV630169 |
ABM |
1.0 ug DNA |
EUR 514 |
STK38 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV630173 |
ABM |
1.0 ug DNA |
EUR 514 |
STK38 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV630174 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
STK38 Rabbit Polyclonal Antibody