STK40 Rabbit Polyclonal Antibody

STK40 Antibody

36201-100ul 100ul
EUR 252

STK40 antibody

70R-13420 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STK40 antibody

STK40 Antibody

1-CSB-PA158011
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

STK40 Antibody

1-CSB-PA112765
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

Polyclonal STK40 Antibody ( C-term )

APR06136G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK40 ( C-term ). This antibody is tested and proven to work in the following applications:

STK40 Conjugated Antibody

C36201 100ul
EUR 397

Anti-STK40 antibody

STJ191363 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK40

Stk40/ Rat Stk40 ELISA Kit

ELI-41340r 96 Tests
EUR 886

STK40 siRNA

20-abx905335
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STK40 siRNA

20-abx935491
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STK40 siRNA

20-abx935492
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-STK40

YF-PA21285 50 ug
EUR 363
Description: Mouse polyclonal to STK40

anti-STK40

YF-PA21286 100 ul
EUR 403
Description: Rabbit polyclonal to STK40

anti-STK40

YF-PA26700 50 ul
EUR 334
Description: Mouse polyclonal to STK40

STK40 cloning plasmid

CSB-CL854027HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: atggtgctcaacaagaggacacatcggataaccatcaccaacttctgcctcgggaagcatctggtgagcgagggggacctgctgaaggaccagagagggagccctgcctacatcagtcccgacgtgctcagcggccggccgtaccgtggcaagcccagtgacatgtgggccctggg
  • Show more
Description: A cloning plasmid for the STK40 gene.

STK40 cloning plasmid

CSB-CL854027HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atgaagcggagagcatcagacagaggagctggggaaacgtcggccagggccaaggctctaggaagtgggatttctggaaataatgcaaagagagctggaccattcatccttggtccccgtctgggcaactcaccggtgccaagcatagtgcagtgtttggcgaggaaagatggca
  • Show more
Description: A cloning plasmid for the STK40 gene.

pDONR223-STK40 Plasmid

PVTB00842 2 ug
EUR 356

Anti-STK40 (4G3)

YF-MA11688 100 ug
EUR 363
Description: Mouse monoclonal to STK40

Serine/threonine Kinase 40 (STK40) Antibody

abx145680-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

abx034199-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

abx034199-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

20-abx214209
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine Kinase 40 (STK40) Antibody

20-abx214607
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse STK40 shRNA Plasmid

20-abx978130
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STK40 shRNA Plasmid

20-abx990029
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STK40 shRNA Plasmid

20-abx963240
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK40 Recombinant Protein (Human)

RP030442 100 ug Ask for price

STK40 Recombinant Protein (Human)

RP030445 100 ug Ask for price

STK40 Recombinant Protein (Rat)

RP231494 100 ug Ask for price

STK40 Recombinant Protein (Mouse)

RP176108 100 ug Ask for price

STK40 Recombinant Protein (Mouse)

RP176111 100 ug Ask for price

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit

E04S0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit

E04S0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit

E04S0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal STK40 Antibody (monoclonal) (M04), Clone: 4G3

AMM04153G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STK40 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G3. This antibody is applicable in WB and IHC

h STK40 inducible lentiviral particles

LVP202 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK40, is fully sequence verified and matched to NCBI accession ID: NM_032017

Stk40 ORF Vector (Mouse) (pORF)

ORF058704 1.0 ug DNA
EUR 506

Stk40 ORF Vector (Mouse) (pORF)

ORF058705 1.0 ug DNA
EUR 506

STK40 ORF Vector (Human) (pORF)

ORF010148 1.0 ug DNA
EUR 95

STK40 ORF Vector (Human) (pORF)

ORF010149 1.0 ug DNA
EUR 95

Stk40 ORF Vector (Rat) (pORF)

ORF077166 1.0 ug DNA
EUR 506

STK40 sgRNA CRISPR Lentivector set (Human)

K2304901 3 x 1.0 ug
EUR 339

Stk40 sgRNA CRISPR Lentivector set (Mouse)

K4693801 3 x 1.0 ug
EUR 339

Stk40 sgRNA CRISPR Lentivector set (Rat)

K6422301 3 x 1.0 ug
EUR 339

STK40 sgRNA CRISPR Lentivector (Human) (Target 1)

K2304902 1.0 ug DNA
EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 2)

K2304903 1.0 ug DNA
EUR 154

STK40 sgRNA CRISPR Lentivector (Human) (Target 3)

K2304904 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4693802 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4693803 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4693804 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6422302 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6422303 1.0 ug DNA
EUR 154

Stk40 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6422304 1.0 ug DNA
EUR 154

STK40 Protein Vector (Human) (pPB-C-His)

PV040589 500 ng
EUR 329

STK40 Protein Vector (Human) (pPB-N-His)

PV040590 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-HA)

PV040591 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-His)

PV040592 500 ng
EUR 329

STK40 Protein Vector (Human) (pPB-C-His)

PV040593 500 ng
EUR 329

STK40 Protein Vector (Human) (pPB-N-His)

PV040594 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-HA)

PV040595 500 ng
EUR 329

STK40 Protein Vector (Human) (pPM-C-His)

PV040596 500 ng
EUR 329

STK40 Protein Vector (Rat) (pPB-C-His)

PV308662 500 ng
EUR 603

STK40 Protein Vector (Rat) (pPB-N-His)

PV308663 500 ng
EUR 603

STK40 Protein Vector (Rat) (pPM-C-HA)

PV308664 500 ng
EUR 603

STK40 Protein Vector (Rat) (pPM-C-His)

PV308665 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-C-His)

PV234814 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-N-His)

PV234815 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-HA)

PV234816 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-His)

PV234817 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-C-His)

PV234818 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPB-N-His)

PV234819 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-HA)

PV234820 500 ng
EUR 603

STK40 Protein Vector (Mouse) (pPM-C-His)

PV234821 500 ng
EUR 603

Stk40 3'UTR GFP Stable Cell Line

TU169860 1.0 ml Ask for price

Stk40 3'UTR Luciferase Stable Cell Line

TU119860 1.0 ml Ask for price

STK40 3'UTR GFP Stable Cell Line

TU074832 1.0 ml
EUR 2333

STK40 3'UTR Luciferase Stable Cell Line

TU024832 1.0 ml
EUR 2333

Stk40 3'UTR Luciferase Stable Cell Line

TU221326 1.0 ml Ask for price

Stk40 3'UTR GFP Stable Cell Line

TU271326 1.0 ml Ask for price

STK40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665677 1.0 ug DNA
EUR 682

STK40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665681 1.0 ug DNA
EUR 682

STK40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665682 1.0 ug DNA
EUR 682

STK40 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715521 1.0 ug DNA
EUR 316

STK40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715525 1.0 ug DNA
EUR 316

STK40 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715526 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

STK40 Rabbit Polyclonal Antibody