SV2B Rabbit Polyclonal Antibody

SV2B Polyclonal Antibody
ABP60559-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SV2B protein
  • Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody
ABP60559-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SV2B protein
  • Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody
ABP60559-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SV2B protein
  • Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody
A61210 100 µg
EUR 570.55
Description: Ask the seller for details

SV2B Polyclonal Antibody
29791-100ul 100ul
EUR 252

SV2B Polyclonal Antibody
29791-50ul 50ul
EUR 187

SV2B Rabbit pAb
A16269-100ul 100 ul
EUR 308

SV2B Rabbit pAb
A16269-200ul 200 ul
EUR 459

SV2B Rabbit pAb
A16269-20ul 20 ul
EUR 183

SV2B Rabbit pAb
A16269-50ul 50 ul
EUR 223

SV2B Polyclonal Conjugated Antibody
C29791 100ul
EUR 397

SV2B antibody
70R-20659 50 ul
EUR 435
Description: Rabbit polyclonal SV2B antibody

SV2B Antibody
1-CSB-PA022979GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SV2B Antibody
1-CSB-PA022979LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

SV2B Polyclonal Antibody, Biotin Conjugated
A61211 100 µg
EUR 570.55
Description: The best epigenetics products

SV2B Polyclonal Antibody, FITC Conjugated
A61212 100 µg
EUR 570.55
Description: kits suitable for this type of research

SV2B Polyclonal Antibody, HRP Conjugated
A61213 100 µg
EUR 570.55
Description: fast delivery possible

Sv2b/ Rat Sv2b ELISA Kit
ELI-46218r 96 Tests
EUR 886

anti- SV2B antibody
FNab08407 100µg
EUR 548.75
  • Immunogen: synaptic vesicle glycoprotein 2B
  • Uniprot ID: Q7L1I2
  • Gene ID: 9899
  • Research Area: Neuroscience
Description: Antibody raised against SV2B

Anti-SV2B antibody
PAab08407 100 ug
EUR 386

Anti-SV2B antibody
STJ118718 100 µl
EUR 277

Anti-SV2B antibody
STJ191487 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SV2B

SV2B siRNA
20-abx905384
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SV2B siRNA
20-abx935726
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SV2B siRNA
20-abx935727
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pBlueScriptR-SV2B
PVT17367 2 ug
EUR 231

anti-SV2B
YF-PA16575 50 ug
EUR 363
Description: Mouse polyclonal to SV2B

anti-SV2B
YF-PA16576 100 ug
EUR 403
Description: Rabbit polyclonal to SV2B

anti-SV2B
YF-PA25430 50 ul
EUR 334
Description: Mouse polyclonal to SV2B

SV2B Antibody, HRP conjugated
1-CSB-PA022979LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SV2B Antibody, FITC conjugated
1-CSB-PA022979LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SV2B Antibody, Biotin conjugated
1-CSB-PA022979LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SV2B cloning plasmid
CSB-CL022979HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2052
  • Sequence: atggatgactacaagtatcaggacaattatgggggctatgctcccagtgatggctattaccgcggcaatgagtccaacccagaagaagatgcacagagtgatgtcaccgaaggccatgatgaggaagacgagatctatgagggcgagtaccagggtatccctcacccagatgatg
  • Show more
Description: A cloning plasmid for the SV2B gene.

Anti-SV2B (2C6)
YF-MA17029 100 ug
EUR 363
Description: Mouse monoclonal to SV2B

Mouse SV2B shRNA Plasmid
20-abx975263
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SV2B shRNA Plasmid
20-abx987476
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SV2B ELISA KIT|Human
EF003375 96 Tests
EUR 689

Human SV2B shRNA Plasmid
20-abx956644
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SV2B Recombinant Protein (Human)
RP030697 100 ug Ask for price

SV2B Recombinant Protein (Rat)
RP231794 100 ug Ask for price

SV2B Recombinant Protein (Mouse)
RP176585 100 ug Ask for price

SV2B Recombinant Protein (Mouse)
RP176588 100 ug Ask for price

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody
20-abx318064
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody
abx238407-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (HRP)
20-abx305472
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (FITC)
20-abx305473
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (Biotin)
20-abx305474
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sv2b ORF Vector (Mouse) (pORF)
ORF058863 1.0 ug DNA
EUR 506

Sv2b ORF Vector (Mouse) (pORF)
ORF058864 1.0 ug DNA
EUR 506

SV2B ORF Vector (Human) (pORF)
ORF010233 1.0 ug DNA
EUR 95

Sv2b ORF Vector (Rat) (pORF)
ORF077266 1.0 ug DNA
EUR 506

SV2B sgRNA CRISPR Lentivector set (Human)
K2317701 3 x 1.0 ug
EUR 339

Sv2b sgRNA CRISPR Lentivector set (Mouse)
K4087801 3 x 1.0 ug
EUR 339

Sv2b sgRNA CRISPR Lentivector set (Rat)
K7055201 3 x 1.0 ug
EUR 339

SV2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2317702 1.0 ug DNA
EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2317703 1.0 ug DNA
EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2317704 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4087802 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4087803 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4087804 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7055202 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7055203 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7055204 1.0 ug DNA
EUR 154

SV2B Protein Vector (Human) (pPB-C-His)
PV040929 500 ng
EUR 329

SV2B Protein Vector (Human) (pPB-N-His)
PV040930 500 ng
EUR 329

SV2B Protein Vector (Human) (pPM-C-HA)
PV040931 500 ng
EUR 329

SV2B Protein Vector (Human) (pPM-C-His)
PV040932 500 ng
EUR 329

SV2B Protein Vector (Rat) (pPB-C-His)
PV309062 500 ng
EUR 1191

SV2B Protein Vector (Rat) (pPB-N-His)
PV309063 500 ng
EUR 1191

SV2B Protein Vector (Rat) (pPM-C-HA)
PV309064 500 ng
EUR 1191

SV2B Protein Vector (Rat) (pPM-C-His)
PV309065 500 ng
EUR 1191

SV2B Protein Vector (Mouse) (pPB-C-His)
PV235450 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPB-N-His)
PV235451 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-HA)
PV235452 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-His)
PV235453 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPB-C-His)
PV235454 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPB-N-His)
PV235455 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-HA)
PV235456 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-His)
PV235457 500 ng
EUR 1065

Sv2b 3'UTR GFP Stable Cell Line
TU169975 1.0 ml Ask for price

Sv2b 3'UTR Luciferase Stable Cell Line
TU119975 1.0 ml Ask for price

SV2B 3'UTR GFP Stable Cell Line
TU074968 1.0 ml
EUR 4617

SV2B 3'UTR Luciferase Stable Cell Line
TU024968 1.0 ml
EUR 4617

Sv2b 3'UTR Luciferase Stable Cell Line
TU221431 1.0 ml Ask for price

Sv2b 3'UTR GFP Stable Cell Line
TU271431 1.0 ml Ask for price

Human Synaptic vesicle glycoprotein 2B, SV2B ELISA KIT
ELI-53386h 96 Tests
EUR 824

Mouse Synaptic vesicle glycoprotein 2B, Sv2b ELISA KIT
ELI-53387m 96 Tests
EUR 865

Human Synaptic Vesicle Glycoprotein 2B (SV2B) ELISA Kit
abx383580-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SV2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV653017 1.0 ug DNA
EUR 1355

SV2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV653021 1.0 ug DNA
EUR 1355

SV2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV653022 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SV2B Rabbit Polyclonal Antibody