Biocat Net

Amine biocat 3.0

SV2B Rabbit Polyclonal Antibody

SV2B Polyclonal Antibody

A61210 100 µg
EUR 570.55
Description: Ask the seller for details

SV2B Polyclonal Antibody

ABP60559-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SV2B protein
  • Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody

ABP60559-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SV2B protein
  • Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody

ABP60559-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SV2B protein
  • Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody

ES10329-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SV2B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SV2B Polyclonal Antibody

ES10329-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SV2B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SV2B Rabbit pAb

A16269-100ul 100 ul
EUR 308

SV2B Rabbit pAb

A16269-200ul 200 ul
EUR 459

SV2B Rabbit pAb

A16269-20ul 20 ul
EUR 183

SV2B Rabbit pAb

A16269-50ul 50 ul
EUR 223

SV2B Polyclonal Conjugated Antibody

C29791 100ul
EUR 397

SV2B antibody

70R-20659 50 ul
EUR 435
Description: Rabbit polyclonal SV2B antibody

SV2B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SV2B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

SV2B Polyclonal Antibody, Biotin Conjugated

A61211 100 µg
EUR 570.55
Description: The best epigenetics products

SV2B Polyclonal Antibody, FITC Conjugated

A61212 100 µg
EUR 570.55
Description: kits suitable for this type of research

SV2B Polyclonal Antibody, HRP Conjugated

A61213 100 µg
EUR 570.55
Description: fast delivery possible

Sv2b/ Rat Sv2b ELISA Kit

ELI-46218r 96 Tests
EUR 886

anti- SV2B antibody

FNab08407 100µg
EUR 548.75
  • Immunogen: synaptic vesicle glycoprotein 2B
  • Uniprot ID: Q7L1I2
  • Gene ID: 9899
  • Research Area: Neuroscience
Description: Antibody raised against SV2B

Anti-SV2B antibody

PAab08407 100 ug
EUR 386

Anti-SV2B antibody

STJ118718 100 µl
EUR 277

Anti-SV2B antibody

STJ191487 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SV2B


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17367 2 ug
EUR 231


YF-PA16575 50 ug
EUR 363
Description: Mouse polyclonal to SV2B


YF-PA16576 100 ug
EUR 403
Description: Rabbit polyclonal to SV2B


YF-PA25430 50 ul
EUR 334
Description: Mouse polyclonal to SV2B

SV2B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SV2B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SV2B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SV2B cloning plasmid

CSB-CL022979HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2052
  • Sequence: atggatgactacaagtatcaggacaattatgggggctatgctcccagtgatggctattaccgcggcaatgagtccaacccagaagaagatgcacagagtgatgtcaccgaaggccatgatgaggaagacgagatctatgagggcgagtaccagggtatccctcacccagatgatg
  • Show more
Description: A cloning plasmid for the SV2B gene.

Anti-SV2B (2C6)

YF-MA17029 100 ug
EUR 363
Description: Mouse monoclonal to SV2B


EF003375 96 Tests
EUR 689

Mouse SV2B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SV2B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SV2B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SV2B Recombinant Protein (Rat)

RP231794 100 ug Ask for price

SV2B Recombinant Protein (Human)

RP030697 100 ug Ask for price

SV2B Recombinant Protein (Mouse)

RP176585 100 ug Ask for price

SV2B Recombinant Protein (Mouse)

RP176588 100 ug Ask for price

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody

abx238407-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sv2b ORF Vector (Rat) (pORF)

ORF077266 1.0 ug DNA
EUR 506

SV2B ORF Vector (Human) (pORF)

ORF010233 1.0 ug DNA
EUR 95

Sv2b ORF Vector (Mouse) (pORF)

ORF058863 1.0 ug DNA
EUR 506

Sv2b ORF Vector (Mouse) (pORF)

ORF058864 1.0 ug DNA
EUR 506

Sv2b sgRNA CRISPR Lentivector set (Rat)

K7055201 3 x 1.0 ug
EUR 339

SV2B sgRNA CRISPR Lentivector set (Human)

K2317701 3 x 1.0 ug
EUR 339

Sv2b sgRNA CRISPR Lentivector set (Mouse)

K4087801 3 x 1.0 ug
EUR 339

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7055202 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7055203 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7055204 1.0 ug DNA
EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 1)

K2317702 1.0 ug DNA
EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 2)

K2317703 1.0 ug DNA
EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 3)

K2317704 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4087802 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4087803 1.0 ug DNA
EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4087804 1.0 ug DNA
EUR 154

SV2B Protein Vector (Rat) (pPB-C-His)

PV309062 500 ng
EUR 1191

SV2B Protein Vector (Rat) (pPB-N-His)

PV309063 500 ng
EUR 1191

SV2B Protein Vector (Rat) (pPM-C-HA)

PV309064 500 ng
EUR 1191

SV2B Protein Vector (Rat) (pPM-C-His)

PV309065 500 ng
EUR 1191

SV2B Protein Vector (Human) (pPB-C-His)

PV040929 500 ng
EUR 329

SV2B Protein Vector (Human) (pPB-N-His)

PV040930 500 ng
EUR 329

SV2B Protein Vector (Human) (pPM-C-HA)

PV040931 500 ng
EUR 329

SV2B Protein Vector (Human) (pPM-C-His)

PV040932 500 ng
EUR 329

SV2B Protein Vector (Mouse) (pPB-C-His)

PV235450 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPB-N-His)

PV235451 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-HA)

PV235452 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-His)

PV235453 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPB-C-His)

PV235454 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPB-N-His)

PV235455 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-HA)

PV235456 500 ng
EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-His)

PV235457 500 ng
EUR 1065

Sv2b 3'UTR Luciferase Stable Cell Line

TU119975 1.0 ml Ask for price

Sv2b 3'UTR GFP Stable Cell Line

TU169975 1.0 ml Ask for price

Sv2b 3'UTR Luciferase Stable Cell Line

TU221431 1.0 ml Ask for price

SV2B 3'UTR GFP Stable Cell Line

TU074968 1.0 ml
EUR 4617

Sv2b 3'UTR GFP Stable Cell Line

TU271431 1.0 ml Ask for price

SV2B 3'UTR Luciferase Stable Cell Line

TU024968 1.0 ml
EUR 4617

Human Synaptic vesicle glycoprotein 2B, SV2B ELISA KIT

ELI-53386h 96 Tests
EUR 824

Mouse Synaptic vesicle glycoprotein 2B, Sv2b ELISA KIT

ELI-53387m 96 Tests
EUR 865

Human Synaptic Vesicle Glycoprotein 2B (SV2B) ELISA Kit

abx383580-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SV2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV653017 1.0 ug DNA
EUR 1355

SV2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV653021 1.0 ug DNA
EUR 1355

SV2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV653022 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

SV2B Rabbit Polyclonal Antibody