SV2B Rabbit Polyclonal Antibody

SV2B Polyclonal Antibody
A61210	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SV2B Polyclonal Antibody
ABP60559-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human SV2B protein Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody
ABP60559-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human SV2B protein Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody
ABP60559-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SV2B protein Applications tips:
Description: A polyclonal antibody for detection of SV2B from Human, Mouse, Rat. This SV2B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SV2B protein

SV2B Polyclonal Antibody
ES10329-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SV2B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SV2B Polyclonal Antibody
ES10329-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SV2B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SV2B Rabbit pAb
A16269-100ul	Abclonal	100 ul	EUR 308

SV2B Rabbit pAb
A16269-200ul	Abclonal	200 ul	EUR 459

SV2B Rabbit pAb
A16269-20ul	Abclonal	20 ul	EUR 183

SV2B Rabbit pAb
A16269-50ul	Abclonal	50 ul	EUR 223

SV2B Polyclonal Conjugated Antibody
C29791	SAB	100ul	EUR 397

SV2B antibody
70R-20659	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SV2B antibody

SV2B Antibody
1-CSB-PA022979GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SV2B Antibody
1-CSB-PA022979LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

SV2B Polyclonal Antibody, Biotin Conjugated
A61211	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SV2B Polyclonal Antibody, FITC Conjugated
A61212	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SV2B Polyclonal Antibody, HRP Conjugated
A61213	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Sv2b/ Rat Sv2b ELISA Kit
ELI-46218r	Lifescience Market	96 Tests	EUR 886

anti- SV2B antibody
FNab08407	FN Test	100µg	EUR 548.75
Immunogen: synaptic vesicle glycoprotein 2B Uniprot ID: Q7L1I2 Gene ID: 9899 Research Area: Neuroscience
Description: Antibody raised against SV2B

Anti-SV2B antibody
PAab08407	Lifescience Market	100 ug	EUR 386

Anti-SV2B antibody
STJ118718	St John's Laboratory	100 µl	EUR 277

Anti-SV2B antibody
STJ191487	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SV2B

SV2B siRNA
20-abx905384	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SV2B siRNA
20-abx935726	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SV2B siRNA
20-abx935727	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pBlueScriptR-SV2B
PVT17367	Lifescience Market	2 ug	EUR 231

anti-SV2B
YF-PA16575	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SV2B

anti-SV2B
YF-PA16576	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SV2B

anti-SV2B
YF-PA25430	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SV2B

SV2B Antibody, HRP conjugated
1-CSB-PA022979LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SV2B Antibody, FITC conjugated
1-CSB-PA022979LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SV2B Antibody, Biotin conjugated
1-CSB-PA022979LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SV2B. Recognizes SV2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SV2B cloning plasmid
CSB-CL022979HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2052 Sequence: atggatgactacaagtatcaggacaattatgggggctatgctcccagtgatggctattaccgcggcaatgagtccaacccagaagaagatgcacagagtgatgtcaccgaaggccatgatgaggaagacgagatctatgagggcgagtaccagggtatccctcacccagatgatg Show more
Description: A cloning plasmid for the SV2B gene.

Anti-SV2B (2C6)
YF-MA17029	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SV2B

SV2B ELISA KIT|Human
EF003375	Lifescience Market	96 Tests	EUR 689

Mouse SV2B shRNA Plasmid
20-abx975263	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SV2B shRNA Plasmid
20-abx987476	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SV2B shRNA Plasmid
20-abx956644	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SV2B Recombinant Protein (Rat)
RP231794	ABM	100 ug	Ask for price

SV2B Recombinant Protein (Human)
RP030697	ABM	100 ug	Ask for price

SV2B Recombinant Protein (Mouse)
RP176585	ABM	100 ug	Ask for price

SV2B Recombinant Protein (Mouse)
RP176588	ABM	100 ug	Ask for price

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody
abx238407-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody
20-abx318064	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (HRP)
20-abx305472	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (FITC)
20-abx305473	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Synaptic Vesicle Glycoprotein 2B (SV2B) Antibody (Biotin)
20-abx305474	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sv2b ORF Vector (Rat) (pORF)
ORF077266	ABM	1.0 ug DNA	EUR 506

SV2B ORF Vector (Human) (pORF)
ORF010233	ABM	1.0 ug DNA	EUR 95

Sv2b ORF Vector (Mouse) (pORF)
ORF058863	ABM	1.0 ug DNA	EUR 506

Sv2b ORF Vector (Mouse) (pORF)
ORF058864	ABM	1.0 ug DNA	EUR 506

Sv2b sgRNA CRISPR Lentivector set (Rat)
K7055201	ABM	3 x 1.0 ug	EUR 339

SV2B sgRNA CRISPR Lentivector set (Human)
K2317701	ABM	3 x 1.0 ug	EUR 339

Sv2b sgRNA CRISPR Lentivector set (Mouse)
K4087801	ABM	3 x 1.0 ug	EUR 339

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7055202	ABM	1.0 ug DNA	EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7055203	ABM	1.0 ug DNA	EUR 154

Sv2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7055204	ABM	1.0 ug DNA	EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2317702	ABM	1.0 ug DNA	EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2317703	ABM	1.0 ug DNA	EUR 154

SV2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2317704	ABM	1.0 ug DNA	EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4087802	ABM	1.0 ug DNA	EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4087803	ABM	1.0 ug DNA	EUR 154

Sv2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4087804	ABM	1.0 ug DNA	EUR 154

SV2B Protein Vector (Rat) (pPB-C-His)
PV309062	ABM	500 ng	EUR 1191

SV2B Protein Vector (Rat) (pPB-N-His)
PV309063	ABM	500 ng	EUR 1191

SV2B Protein Vector (Rat) (pPM-C-HA)
PV309064	ABM	500 ng	EUR 1191

SV2B Protein Vector (Rat) (pPM-C-His)
PV309065	ABM	500 ng	EUR 1191

SV2B Protein Vector (Human) (pPB-C-His)
PV040929	ABM	500 ng	EUR 329

SV2B Protein Vector (Human) (pPB-N-His)
PV040930	ABM	500 ng	EUR 329

SV2B Protein Vector (Human) (pPM-C-HA)
PV040931	ABM	500 ng	EUR 329

SV2B Protein Vector (Human) (pPM-C-His)
PV040932	ABM	500 ng	EUR 329

SV2B Protein Vector (Mouse) (pPB-C-His)
PV235450	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPB-N-His)
PV235451	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-HA)
PV235452	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-His)
PV235453	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPB-C-His)
PV235454	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPB-N-His)
PV235455	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-HA)
PV235456	ABM	500 ng	EUR 1065

SV2B Protein Vector (Mouse) (pPM-C-His)
PV235457	ABM	500 ng	EUR 1065

Sv2b 3'UTR Luciferase Stable Cell Line
TU119975	ABM	1.0 ml	Ask for price

Sv2b 3'UTR GFP Stable Cell Line
TU169975	ABM	1.0 ml	Ask for price

Sv2b 3'UTR Luciferase Stable Cell Line
TU221431	ABM	1.0 ml	Ask for price

SV2B 3'UTR GFP Stable Cell Line
TU074968	ABM	1.0 ml	EUR 4617

Sv2b 3'UTR GFP Stable Cell Line
TU271431	ABM	1.0 ml	Ask for price

SV2B 3'UTR Luciferase Stable Cell Line
TU024968	ABM	1.0 ml	EUR 4617

Human Synaptic vesicle glycoprotein 2B, SV2B ELISA KIT
ELI-53386h	Lifescience Market	96 Tests	EUR 824

Mouse Synaptic vesicle glycoprotein 2B, Sv2b ELISA KIT
ELI-53387m	Lifescience Market	96 Tests	EUR 865

Human Synaptic Vesicle Glycoprotein 2B (SV2B) ELISA Kit
abx383580-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SV2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV653017	ABM	1.0 ug DNA	EUR 1355

SV2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV653021	ABM	1.0 ug DNA	EUR 1355

SV2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV653022	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

SV2B Rabbit Polyclonal Antibody