SYT4 Polyclonal Antibody |
ABP60576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SYT4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SYT4 from Human. This SYT4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT4 protein |
SYT4 Rabbit pAb |
A7737-100ul |
Abclonal |
100 ul |
EUR 308 |
SYT4 Rabbit pAb |
A7737-200ul |
Abclonal |
200 ul |
EUR 459 |
SYT4 Rabbit pAb |
A7737-20ul |
Abclonal |
20 ul |
EUR 183 |
SYT4 Rabbit pAb |
A7737-50ul |
Abclonal |
50 ul |
EUR 223 |
SYT4 antibody |
70R-20679 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SYT4 antibody |
SYT4 Antibody |
35935-100ul |
SAB |
100ul |
EUR 252 |
SYT4 Antibody |
DF9954 |
Affbiotech |
200ul |
EUR 304 |
Description: SYT4 Antibody detects endogenous levels of total SYT4. |
SYT4 Antibody |
1-CSB-PA875654ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SYT4 Antibody |
1-CSB-PA875654ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
SYT4 Antibody |
1-CSB-PA577153 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
SYT4 Antibody |
1-CSB-PA193423 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
SYT4 Antibody |
1-CSB-PA023040GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
SYT4 Conjugated Antibody |
C35935 |
SAB |
100ul |
EUR 397 |
Anti-SYT4 antibody |
STJ191493 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SYT4 |
SYT4 siRNA |
20-abx905417 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT4 siRNA |
20-abx935859 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT4 siRNA |
20-abx935860 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Iv (SYT4) Antibody |
20-abx115951 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
20-abx142253 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
20-abx006522 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
abx030963-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
abx030963-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
20-abx320634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
20-abx322181 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin-4 (Syt4) Antibody |
abx238430-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Synaptotagmin-4 (Syt4) Antibody |
abx238431-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
20-abx241612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 4 (SYT4) Antibody |
20-abx241928 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT4 cloning plasmid |
CSB-CL875654HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1278
- Sequence: atggctccgatcaccaccagccgggaagaatttgatgaaatccccacagtggtggggatcttcagtgcatttggcctggtcttcacagtctctctctttgcatggatctgctgtcagagaaaatcatccaagtctaacaagactcctccatacaagtttgtgcatgtgcttaagg
- Show more
|
Description: A cloning plasmid for the SYT4 gene. |
SYT4 Blocking Peptide |
DF9954-BP |
Affbiotech |
1mg |
EUR 195 |
Rat SYT4 shRNA Plasmid |
20-abx986237 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Synaptotagmin 4 (SYT4) Protein |
20-abx263338 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human SYT4 shRNA Plasmid |
20-abx954690 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYT4 protein (His tag) |
80R-2686 |
Fitzgerald |
20 ug |
EUR 322 |
Description: Purified recombinant SYT4 protein (His tag) |
Mouse SYT4 shRNA Plasmid |
20-abx972975 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYT4 Recombinant Protein (Human) |
RP030784 |
ABM |
100 ug |
Ask for price |
SYT4 Recombinant Protein (Rat) |
RP231989 |
ABM |
100 ug |
Ask for price |
SYT4 Recombinant Protein (Mouse) |
RP176888 |
ABM |
100 ug |
Ask for price |
Monoclonal SYT4 Antibody (monoclonal) (M04), Clone: 5F8 |
AMM04162G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human SYT4 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F8. This antibody is applicable in WB and IF, E |
Syt4 ORF Vector (Mouse) (pORF) |
ORF058964 |
ABM |
1.0 ug DNA |
EUR 506 |
SYT4 ORF Vector (Human) (pORF) |
ORF010262 |
ABM |
1.0 ug DNA |
EUR 95 |
Syt4 ORF Vector (Rat) (pORF) |
ORF077331 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Synaptotagmin 4 (SYT4) ELISA Kit |
abx383593-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Synaptotagmin IV (SYT4)ELISA Kit |
201-12-2569 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin IV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
SYT4 sgRNA CRISPR Lentivector set (Human) |
K2322801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat Synaptotagmin-4(SYT4) ELISA kit |
CSB-EL023040RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Synaptotagmin-4 (SYT4) in samples from serum, plasma, cerebrospinalfluid (CSF), tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Synaptotagmin-4(SYT4) ELISA kit |
1-CSB-EL023040RA |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Synaptotagmin-4(SYT4) in samples from serum, plasma, cerebrospinalfluid(CSF), tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
SYT4 Synaptotagmin IV Human Recombinant Protein |
PROTQ9H2B2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: SYT4 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 409 amino acids (38-425a.a) and having a molecular mass of 46.1kDa. SYT4 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Syt4 sgRNA CRISPR Lentivector set (Rat) |
K6948101 |
ABM |
3 x 1.0 ug |
EUR 339 |
SYT4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2322802 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2322803 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2322804 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat Synaptotagmin-4 (SYT4) |
KTE100161-48T |
Abbkine |
48T |
EUR 332 |
- may play a role in synaptic vesicle transport
- may be involved in synaptic changes in response to seizure activity [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-4 (SYT4) |
KTE100161-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- may play a role in synaptic vesicle transport
- may be involved in synaptic changes in response to seizure activity [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-4 (SYT4) |
KTE100161-96T |
Abbkine |
96T |
EUR 539 |
- may play a role in synaptic vesicle transport
- may be involved in synaptic changes in response to seizure activity [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-4 (SYT4) |
KTE70305-48T |
Abbkine |
48T |
EUR 332 |
- May be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. Plays a role in dendrite formation by melan
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-4 (SYT4) |
KTE70305-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- May be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. Plays a role in dendrite formation by melan
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-4 (SYT4) |
KTE70305-96T |
Abbkine |
96T |
EUR 539 |
- May be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. Plays a role in dendrite formation by melan
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Syt4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6948102 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6948103 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6948104 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Synaptotagmin-4 (SYT4) |
KTE60435-48T |
Abbkine |
48T |
EUR 332 |
- SYT4 (Synaptotagmin 4) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding and syntaxin binding. An important paralog of this gene is SYT11. Synaptotagmin 4 may be involved in Ca(2+)-dependent exocytosis of secre
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-4 (SYT4) |
KTE60435-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT4 (Synaptotagmin 4) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding and syntaxin binding. An important paralog of this gene is SYT11. Synaptotagmin 4 may be involved in Ca(2+)-dependent exocytosis of secre
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-4 (SYT4) |
KTE60435-96T |
Abbkine |
96T |
EUR 539 |
- SYT4 (Synaptotagmin 4) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding and syntaxin binding. An important paralog of this gene is SYT11. Synaptotagmin 4 may be involved in Ca(2+)-dependent exocytosis of secre
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SYT4 Protein Vector (Human) (pPB-C-His) |
PV041045 |
ABM |
500 ng |
EUR 329 |
SYT4 Protein Vector (Human) (pPB-N-His) |
PV041046 |
ABM |
500 ng |
EUR 329 |
SYT4 Protein Vector (Human) (pPM-C-HA) |
PV041047 |
ABM |
500 ng |
EUR 329 |
SYT4 Protein Vector (Human) (pPM-C-His) |
PV041048 |
ABM |
500 ng |
EUR 329 |
Recombinant Human SYT4 Protein, His, E.coli-100ug |
QP13661-100ug |
EnQuireBio |
100ug |
EUR 1261 |
Recombinant Human SYT4 Protein, His, E.coli-10ug |
QP13661-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human SYT4 Protein, His, E.coli-2ug |
QP13661-2ug |
EnQuireBio |
2ug |
EUR 155 |
SYT4 Protein Vector (Rat) (pPB-C-His) |
PV309322 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Rat) (pPB-N-His) |
PV309323 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Rat) (pPM-C-HA) |
PV309324 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Rat) (pPM-C-His) |
PV309325 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Mouse) (pPB-C-His) |
PV235854 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Mouse) (pPB-N-His) |
PV235855 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Mouse) (pPM-C-HA) |
PV235856 |
ABM |
500 ng |
EUR 603 |
SYT4 Protein Vector (Mouse) (pPM-C-His) |
PV235857 |
ABM |
500 ng |
EUR 603 |
SYT4 3'UTR GFP Stable Cell Line |
TU075024 |
ABM |
1.0 ml |
EUR 1521 |
SYT4 3'UTR Luciferase Stable Cell Line |
TU025024 |
ABM |
1.0 ml |
EUR 1521 |
Syt4 3'UTR Luciferase Stable Cell Line |
TU221491 |
ABM |
1.0 ml |
Ask for price |
Syt4 3'UTR GFP Stable Cell Line |
TU271491 |
ABM |
1.0 ml |
Ask for price |
SYT4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV696493 |
ABM |
1.0 ug DNA |
EUR 682 |
SYT4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV696497 |
ABM |
1.0 ug DNA |
EUR 682 |
SYT4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV696498 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SYT4 Rabbit Polyclonal Antibody