SYT4 Rabbit Polyclonal Antibody

SYT4 Polyclonal Antibody

ES10335-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT4 Rabbit pAb

A7737-100ul 100 ul
EUR 308

SYT4 Rabbit pAb

A7737-200ul 200 ul
EUR 459

SYT4 Rabbit pAb

A7737-20ul 20 ul
EUR 183

SYT4 Rabbit pAb

A7737-50ul 50 ul
EUR 223

SYT4 antibody

70R-20679 50 ul
EUR 435
Description: Rabbit polyclonal SYT4 antibody

SYT4 Antibody

35935-100ul 100ul
EUR 252

SYT4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SYT4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

SYT4 Antibody

DF9954 200ul
EUR 304
Description: SYT4 Antibody detects endogenous levels of total SYT4.

SYT4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SYT4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SYT4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SYT4. Recognizes SYT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SYT4 Antibody

ABD9954 100 ug
EUR 438

Syt4/ Rat Syt4 ELISA Kit

ELI-41703r 96 Tests
EUR 886

SYT4 Conjugated Antibody

C35935 100ul
EUR 397

Anti-SYT4 antibody

STJ110048 100 µl
EUR 277

Anti-SYT4 antibody

STJ191493 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin Iv (SYT4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

abx030963-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

abx030963-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Synaptotagmin-4 (Syt4) Antibody

abx238430-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptotagmin-4 (Syt4) Antibody

abx238431-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptotagmin 4 (SYT4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 4 (SYT4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

SYT4 Blocking Peptide

DF9954-BP 1mg
EUR 195

SYT4 cloning plasmid

CSB-CL875654HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1278
  • Sequence: atggctccgatcaccaccagccgggaagaatttgatgaaatccccacagtggtggggatcttcagtgcatttggcctggtcttcacagtctctctctttgcatggatctgctgtcagagaaaatcatccaagtctaacaagactcctccatacaagtttgtgcatgtgcttaagg
  • Show more
Description: A cloning plasmid for the SYT4 gene.

SYT4 protein (His tag)

80R-2686 20 ug
EUR 322
Description: Purified recombinant SYT4 protein (His tag)

Synaptotagmin 4 (SYT4) Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Mouse SYT4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYT4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT4 Recombinant Protein (Rat)

RP231989 100 ug Ask for price

SYT4 Recombinant Protein (Human)

RP030784 100 ug Ask for price

SYT4 Recombinant Protein (Mouse)

RP176888 100 ug Ask for price

Monoclonal SYT4 Antibody (monoclonal) (M04), Clone: 5F8

AMM04162G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SYT4 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F8. This antibody is applicable in WB and IF, E

Syt4 ORF Vector (Rat) (pORF)

ORF077331 1.0 ug DNA
EUR 506

SYT4 ORF Vector (Human) (pORF)

ORF010262 1.0 ug DNA
EUR 95

Syt4 ORF Vector (Mouse) (pORF)

ORF058964 1.0 ug DNA
EUR 506

SYT4 ELISA Kit (Rat) (OKCA01005)

OKCA01005 96 Wells
EUR 833
Description: Description of target: May be involved in Ca2+-independent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis . Plays a role in dendrite formation by melanocytes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 pg/mL

Human Synaptotagmin IV (SYT4)ELISA Kit

201-12-2569 96 tests
EUR 440
  • This Synaptotagmin IV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Synaptotagmin-4(SYT4) ELISA kit

CSB-EL023040RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Synaptotagmin-4 (SYT4) in samples from serum, plasma, cerebrospinalfluid (CSF), tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Synaptotagmin-4(SYT4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Synaptotagmin-4(SYT4) in samples from serum, plasma, cerebrospinalfluid(CSF), tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Synaptotagmin- 4, SYT4 ELISA KIT

ELI-46282h 96 Tests
EUR 824

Human Synaptotagmin 4 (SYT4) ELISA Kit

abx383593-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Synaptotagmin- 4, Syt4 ELISA KIT

ELI-41702m 96 Tests
EUR 865

Syt4 sgRNA CRISPR Lentivector set (Rat)

K6948101 3 x 1.0 ug
EUR 339

SYT4 sgRNA CRISPR Lentivector set (Human)

K2322801 3 x 1.0 ug
EUR 339

SYT4 Synaptotagmin IV Human Recombinant Protein

PROTQ9H2B2 Regular: 10ug
EUR 317
Description: SYT4 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 409 amino acids (38-425a.a) and having a molecular mass of 46.1kDa. SYT4 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Synaptotagmin IV(SYT4)ELISA Kit

QY-E01190 96T
EUR 361

ELISA kit for Rat Synaptotagmin-4 (SYT4)

KTE100161-48T 48T
EUR 332
  • may play a role in synaptic vesicle transport
  • may be involved in synaptic changes in response to seizure activity [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-4 (SYT4)

KTE100161-5platesof96wells 5 plates of 96 wells
EUR 2115
  • may play a role in synaptic vesicle transport
  • may be involved in synaptic changes in response to seizure activity [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-4 (SYT4)

KTE100161-96T 96T
EUR 539
  • may play a role in synaptic vesicle transport
  • may be involved in synaptic changes in response to seizure activity [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syt4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6948102 1.0 ug DNA
EUR 154

Syt4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6948103 1.0 ug DNA
EUR 154

Syt4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6948104 1.0 ug DNA
EUR 154

SYT4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2322802 1.0 ug DNA
EUR 154

SYT4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2322803 1.0 ug DNA
EUR 154

SYT4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2322804 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-4 (SYT4)

KTE60435-48T 48T
EUR 332
  • SYT4 (Synaptotagmin 4) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding and syntaxin binding. An important paralog of this gene is SYT11. Synaptotagmin 4 may be involved in Ca(2+)-dependent exocytosis of secre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-4 (SYT4)

KTE60435-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT4 (Synaptotagmin 4) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding and syntaxin binding. An important paralog of this gene is SYT11. Synaptotagmin 4 may be involved in Ca(2+)-dependent exocytosis of secre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-4 (SYT4)

KTE60435-96T 96T
EUR 539
  • SYT4 (Synaptotagmin 4) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding and syntaxin binding. An important paralog of this gene is SYT11. Synaptotagmin 4 may be involved in Ca(2+)-dependent exocytosis of secre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-4 (SYT4)

KTE70305-48T 48T
EUR 332
  • May be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. Plays a role in dendrite formation by melan
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-4 (SYT4)

KTE70305-5platesof96wells 5 plates of 96 wells
EUR 2115
  • May be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. Plays a role in dendrite formation by melan
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-4 (SYT4)

KTE70305-96T 96T
EUR 539
  • May be involved in Ca2+-dependent exocytosis of secretory vesicles through Ca2+ and phospholipid binding to the C2 domain or may serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. Plays a role in dendrite formation by melan
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-4 (SYT4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT4 Protein Vector (Rat) (pPB-C-His)

PV309322 500 ng
EUR 603

SYT4 Protein Vector (Rat) (pPB-N-His)

PV309323 500 ng
EUR 603

SYT4 Protein Vector (Rat) (pPM-C-HA)

PV309324 500 ng
EUR 603

SYT4 Protein Vector (Rat) (pPM-C-His)

PV309325 500 ng
EUR 603

SYT4 Protein Vector (Human) (pPB-C-His)

PV041045 500 ng
EUR 329

SYT4 Protein Vector (Human) (pPB-N-His)

PV041046 500 ng
EUR 329

SYT4 Protein Vector (Human) (pPM-C-HA)

PV041047 500 ng
EUR 329

SYT4 Protein Vector (Human) (pPM-C-His)

PV041048 500 ng
EUR 329

SYT4 Protein Vector (Mouse) (pPB-C-His)

PV235854 500 ng
EUR 603

SYT4 Protein Vector (Mouse) (pPB-N-His)

PV235855 500 ng
EUR 603

SYT4 Protein Vector (Mouse) (pPM-C-HA)

PV235856 500 ng
EUR 603

SYT4 Protein Vector (Mouse) (pPM-C-His)

PV235857 500 ng
EUR 603

Recombinant Human SYT4 Protein, His, E.coli-100ug

QP13661-100ug 100ug
EUR 1261

Recombinant Human SYT4 Protein, His, E.coli-10ug

QP13661-10ug 10ug
EUR 201

Recombinant Human SYT4 Protein, His, E.coli-2ug

QP13661-2ug 2ug
EUR 155

Syt4 3'UTR Luciferase Stable Cell Line

TU221491 1.0 ml Ask for price

SYT4 3'UTR GFP Stable Cell Line

TU075024 1.0 ml
EUR 1521

Syt4 3'UTR GFP Stable Cell Line

TU271491 1.0 ml Ask for price

SYT4 3'UTR Luciferase Stable Cell Line

TU025024 1.0 ml
EUR 1521

SYT4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV696493 1.0 ug DNA
EUR 682

SYT4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV696497 1.0 ug DNA
EUR 682

SYT4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV696498 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

SYT4 Rabbit Polyclonal Antibody