 SYT5 Rabbit pAb |
|
A15321-100ul |
Abclonal |
100 ul |
EUR 308 |
SYT5 Rabbit pAb |
|
A15321-200ul |
Abclonal |
200 ul |
EUR 459 |
SYT5 Rabbit pAb |
|
A15321-20ul |
Abclonal |
20 ul |
EUR 183 |
SYT5 Rabbit pAb |
|
A15321-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal SYT5 Antibody (Center) |
|
APR10369G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT5 (Center). This antibody is tested and proven to work in the following applications: |
 SYT5 antibody |
|
70R-9792 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal SYT5 antibody |
 SYT5 Antibody |
|
35936-100ul |
SAB |
100ul |
EUR 252 |
SYT5 Antibody |
|
1-CSB-PA447958 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SYT5. Recognizes SYT5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50 |
SYT5 Antibody |
|
1-CSB-PA074430 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SYT5. Recognizes SYT5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50 |
 SYT5 Conjugated Antibody |
|
C35936 |
SAB |
100ul |
EUR 397 |
 Anti-SYT5 antibody |
|
STJ191494 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SYT5 |
 SYT5 siRNA |
|
20-abx905418 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT5 siRNA |
|
20-abx935861 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT5 siRNA |
|
20-abx935862 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Synaptotagmin 5 (SYT5) Antibody |
|
abx146115-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Synaptotagmin 5 (SYT5) Antibody |
|
abx027780-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Synaptotagmin 5 (SYT5) Antibody |
|
abx027780-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Synaptotagmin 5 (SYT5) Antibody |
|
20-abx213977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 5 (SYT5) Antibody |
|
20-abx213978 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Synaptotagmin-5 (Syt5) Antibody |
|
abx431969-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 SYT5 cloning plasmid |
|
CSB-CL023041HU-10ug |
Cusabio |
10ug |
EUR 434 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1161
- Sequence: atgttcccggagcccccaaccccggggcctccatcgcccgacacgcctcccgactccagtcgcatcagccacggcccagtgcccccctgggccctggccaccatcgtgctggtctcaggcctcctcatcttcagctgctgtttctgtctctaccggaagagctgtcggaggcgga
- Show more
|
|
Description: A cloning plasmid for the SYT5 gene. |
 SYT5 Blocking Peptide |
|
33R-10175 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYT5 antibody, catalog no. 70R-9792 |
 Mouse SYT5 shRNA Plasmid |
|
20-abx974346 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat SYT5 shRNA Plasmid |
|
20-abx985834 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Protein) Synaptotagmin 5 (SYT5) Protein |
|
20-abx262716 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Human SYT5 shRNA Plasmid |
|
20-abx954691 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SYT5 protein (His tag) |
|
80R-3523 |
Fitzgerald |
50 ug |
EUR 327 |
|
Description: Purified recombinant SYT5 protein (His tag) |
) SYT5 Recombinant Protein (Human) |
|
RP030787 |
ABM |
100 ug |
Ask for price |
) SYT5 Recombinant Protein (Rat) |
|
RP231992 |
ABM |
100 ug |
Ask for price |
) SYT5 Recombinant Protein (Mouse) |
|
RP176891 |
ABM |
100 ug |
Ask for price |
 (pORF)) Syt5 ORF Vector (Mouse) (pORF) |
|
ORF058965 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SYT5 ORF Vector (Human) (pORF) |
|
ORF010263 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Syt5 ORF Vector (Rat) (pORF) |
|
ORF077332 |
ABM |
1.0 ug DNA |
EUR 506 |
ELISA Kit) Human Synaptotagmin V (SYT5)ELISA Kit |
|
201-12-2570 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin V ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
) SYT5 sgRNA CRISPR Lentivector set (Human) |
|
K2322901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Syt5 sgRNA CRISPR Lentivector set (Mouse) |
|
K3740701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 SYT5 Synaptotagmin V Human Recombinant Protein |
|
PROTO00445 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: SYT5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (109-386aa) and having a molecular mass of 33.6kDa. |
) Syt5 sgRNA CRISPR Lentivector set (Rat) |
|
K6909001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) SYT5 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2322902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SYT5 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2322903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SYT5 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2322904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Syt5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3740702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syt5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3740703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syt5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3740704 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Rat Synaptotagmin-5 (SYT5) |
|
KTE100162-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as nega
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-5 (SYT5) |
|
KTE100162-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as nega
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-5 (SYT5) |
|
KTE100162-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as nega
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Synaptotagmin-5 (SYT5) |
|
KTE70306-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-5 (SYT5) |
|
KTE70306-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-5 (SYT5) |
|
KTE70306-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (Target 1)) Syt5 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6909002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Syt5 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6909003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Syt5 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6909004 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Human Synaptotagmin-5 (SYT5) |
|
KTE60436-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-5 (SYT5) |
|
KTE60436-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-5 (SYT5) |
|
KTE60436-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (pPB-C-His)) SYT5 Protein Vector (Human) (pPB-C-His) |
|
PV041049 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SYT5 Protein Vector (Human) (pPB-N-His) |
|
PV041050 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SYT5 Protein Vector (Human) (pPM-C-HA) |
|
PV041051 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SYT5 Protein Vector (Human) (pPM-C-His) |
|
PV041052 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human SYT5 Protein, His, E.coli-10ug |
|
QP13662-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human SYT5 Protein, His, E.coli-1mg |
|
QP13662-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human SYT5 Protein, His, E.coli-2ug |
|
QP13662-2ug |
EnQuireBio |
2ug |
EUR 155 |
 (pPB-C-His)) SYT5 Protein Vector (Rat) (pPB-C-His) |
|
PV309326 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYT5 Protein Vector (Rat) (pPB-N-His) |
|
PV309327 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYT5 Protein Vector (Rat) (pPM-C-HA) |
|
PV309328 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYT5 Protein Vector (Rat) (pPM-C-His) |
|
PV309329 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SYT5 Protein Vector (Mouse) (pPB-C-His) |
|
PV235858 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SYT5 Protein Vector (Mouse) (pPB-N-His) |
|
PV235859 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SYT5 Protein Vector (Mouse) (pPM-C-HA) |
|
PV235860 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SYT5 Protein Vector (Mouse) (pPM-C-His) |
|
PV235861 |
ABM |
500 ng |
EUR 603 |
 Syt5 3'UTR GFP Stable Cell Line |
|
TU170046 |
ABM |
1.0 ml |
Ask for price |
 Syt5 3'UTR Luciferase Stable Cell Line |
|
TU120046 |
ABM |
1.0 ml |
Ask for price |
 SYT5 3'UTR GFP Stable Cell Line |
|
TU075025 |
ABM |
1.0 ml |
EUR 1394 |
 SYT5 3'UTR Luciferase Stable Cell Line |
|
TU025025 |
ABM |
1.0 ml |
EUR 1394 |
Syt5 3'UTR Luciferase Stable Cell Line |
|
TU221492 |
ABM |
1.0 ml |
Ask for price |
Syt5 3'UTR GFP Stable Cell Line |
|
TU271492 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) SYT5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV695107 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) SYT5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV695111 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) SYT5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV695112 |
ABM |
1.0 ug DNA |
EUR 682 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
SYT5 Rabbit Polyclonal Antibody
ELISA Kit)