SYT7 Polyclonal Antibody |
ABP60578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SYT7 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SYT7 from Human, Mouse. This SYT7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT7 protein |
SYT7 Polyclonal Antibody |
ES10337-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SYT7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SYT7 Polyclonal Antibody |
ES10337-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SYT7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SYT7 Rabbit pAb |
A12757-100ul |
Abclonal |
100 ul |
EUR 308 |
SYT7 Rabbit pAb |
A12757-200ul |
Abclonal |
200 ul |
EUR 459 |
SYT7 Rabbit pAb |
A12757-20ul |
Abclonal |
20 ul |
EUR 183 |
SYT7 Rabbit pAb |
A12757-50ul |
Abclonal |
50 ul |
EUR 223 |
SYT7 Antibody |
35938-100ul |
SAB |
100ul |
EUR 252 |
SYT7 Antibody |
1-CSB-PA120806 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SYT7. Recognizes SYT7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50 |
SYT7 Antibody |
1-CSB-PA592388 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SYT7. Recognizes SYT7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:15-1:50 |
Polyclonal Syt7 Antibody (internal region) |
APR13660G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Syt7 (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal SYT7 antibody - C-terminal region |
APR13661G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT7 - C-terminal region. This antibody is tested and proven to work in the following applications: |
SYT7 Conjugated Antibody |
C35938 |
SAB |
100ul |
EUR 397 |
Anti-SYT7 antibody |
STJ114630 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-SYT7 antibody |
STJ191495 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SYT7 |
SYT7 siRNA |
20-abx935865 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYT7 siRNA |
20-abx935866 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 7 (SYT7) Antibody |
abx027983-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Synaptotagmin 7 (SYT7) Antibody |
abx027983-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Synaptotagmin 7 (SYT7) Antibody |
20-abx212275 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 7 (SYT7) Antibody |
20-abx212333 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin 7 (SYT7) Antibody |
abx145710-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Synaptotagmin 7 (Syt7) Antibody |
abx431984-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Synaptotagmin-7 (Syt7) Antibody |
abx445035-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
SYT7 cloning plasmid |
CSB-CL023043HU-10ug |
Cusabio |
10ug |
EUR 448 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1212
- Sequence: ATGTACCGGGACCCGGAGGCGGCCAGCCCAGGGGCGCCCTCGCGCGACGTCCTGCTGGTCTCTGCCATCATCACCGTCAGCCTTAGCGTCACTGTCGTCCTCTGCGGCCTCTGCCACTGGTGTCAGCGCAAACTGGGCAAACGCTACAAGAATTCCTTGGAGACGGTGGGCACGC
- Show more
|
Description: A cloning plasmid for the SYT7 gene. |
Synaptotagmin-7 (Syt7) Antibody (ALP) |
abx442432-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (APC) |
abx442713-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (Biotin) |
abx442993-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (FITC) |
abx443273-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (HRP) |
abx443554-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (PerCP) |
abx444116-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (RPE) |
abx444397-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (Streptavidin) |
abx444678-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mouse SYT7 shRNA Plasmid |
20-abx974511 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SYT7 shRNA Plasmid |
20-abx955984 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYT7 Recombinant Protein (Rat) |
RP231998 |
ABM |
100 ug |
Ask for price |
SYT7 Recombinant Protein (Human) |
RP043903 |
ABM |
100 ug |
Ask for price |
SYT7 Recombinant Protein (Mouse) |
RP176897 |
ABM |
100 ug |
Ask for price |
SYT7 Recombinant Protein (Mouse) |
RP176900 |
ABM |
100 ug |
Ask for price |
SYT7 Recombinant Protein (Mouse) |
RP176903 |
ABM |
100 ug |
Ask for price |
Synaptotagmin-7 (Syt7) Antibody (ATTO 390) |
abx440184-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 488) |
abx440465-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 565) |
abx440746-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 594) |
abx441027-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 633) |
abx441308-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 655) |
abx441589-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 680) |
abx441870-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (ATTO 700) |
abx442151-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Synaptotagmin-7 (Syt7) Antibody (PE/ATTO 594) |
abx443835-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
Syt7 ORF Vector (Rat) (pORF) |
ORF077334 |
ABM |
1.0 ug DNA |
EUR 506 |
SYT7 ORF Vector (Human) (pORF) |
ORF014635 |
ABM |
1.0 ug DNA |
EUR 354 |
Syt7 ORF Vector (Mouse) (pORF) |
ORF058967 |
ABM |
1.0 ug DNA |
EUR 506 |
Syt7 ORF Vector (Mouse) (pORF) |
ORF058968 |
ABM |
1.0 ug DNA |
EUR 506 |
Syt7 ORF Vector (Mouse) (pORF) |
ORF058969 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Synaptotagmin VII (SYT7)ELISA Kit |
201-12-2572 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin VII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin 7 (SYT7) ELISA Kit |
20-abx258615 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Synaptotagmin 7 (SYT7) CLIA Kit |
20-abx495367 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Syt7 sgRNA CRISPR Lentivector set (Rat) |
K6766701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Syt7 sgRNA CRISPR Lentivector set (Mouse) |
K4447801 |
ABM |
3 x 1.0 ug |
EUR 339 |
SYT7 sgRNA CRISPR Lentivector set (Human) |
K2323101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Synaptotagmin VII (SYT7) ELISA Kit |
SEH077Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin VII (SYT7) ELISA Kit |
SEH077Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin VII (SYT7) ELISA Kit |
SEH077Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin VII (SYT7) ELISA Kit |
SEH077Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin VII (SYT7) ELISA Kit |
4-SEH077Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Synaptotagmin VII elisa. Alternative names of the recognized antigen: IPCA-7
- PCANAP7
- SYT-VII
- Prostate Cancer Associated Protein 7
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Synaptotagmin VII (SYT7) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human SYT7 (Synaptotagmin VII) |
ELK5374 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Synaptotagmin VII (SYT7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Synaptota
- Show more
|
Description: A sandwich ELISA kit for detection of Synaptotagmin VII from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Syt7 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6766702 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt7 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6766703 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt7 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6766704 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4447802 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4447803 |
ABM |
1.0 ug DNA |
EUR 154 |
Syt7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4447804 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT7 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2323102 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT7 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2323103 |
ABM |
1.0 ug DNA |
EUR 154 |
SYT7 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2323104 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Synaptotagmin-7 (SYT7) |
KTE60438-48T |
Abbkine |
48T |
EUR 332 |
- SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-7 (SYT7) |
KTE60438-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-7 (SYT7) |
KTE60438-96T |
Abbkine |
96T |
EUR 539 |
- SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-7 (SYT7) |
KTE70308-48T |
Abbkine |
48T |
EUR 332 |
- SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-7 (SYT7) |
KTE70308-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-7 (SYT7) |
KTE70308-96T |
Abbkine |
96T |
EUR 539 |
- SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SYT7 Protein Vector (Rat) (pPB-C-His) |
PV309334 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Rat) (pPB-N-His) |
PV309335 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Rat) (pPM-C-HA) |
PV309336 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Rat) (pPM-C-His) |
PV309337 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Human) (pPB-C-His) |
PV058537 |
ABM |
500 ng |
EUR 481 |
SYT7 Protein Vector (Human) (pPB-N-His) |
PV058538 |
ABM |
500 ng |
EUR 481 |
SYT7 Protein Vector (Human) (pPM-C-HA) |
PV058539 |
ABM |
500 ng |
EUR 481 |
SYT7 Protein Vector (Human) (pPM-C-His) |
PV058540 |
ABM |
500 ng |
EUR 481 |
SYT7 Protein Vector (Mouse) (pPB-C-His) |
PV235866 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPB-N-His) |
PV235867 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPM-C-HA) |
PV235868 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPM-C-His) |
PV235869 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPB-C-His) |
PV235870 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPB-N-His) |
PV235871 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPM-C-HA) |
PV235872 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPM-C-His) |
PV235873 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPB-C-His) |
PV235874 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPB-N-His) |
PV235875 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPM-C-HA) |
PV235876 |
ABM |
500 ng |
EUR 603 |
SYT7 Protein Vector (Mouse) (pPM-C-His) |
PV235877 |
ABM |
500 ng |
EUR 603 |
Syt7 3'UTR Luciferase Stable Cell Line |
TU120048 |
ABM |
1.0 ml |
Ask for price |
Syt7 3'UTR GFP Stable Cell Line |
TU170048 |
ABM |
1.0 ml |
Ask for price |
Syt7 3'UTR Luciferase Stable Cell Line |
TU221494 |
ABM |
1.0 ml |
Ask for price |
SYT7 3'UTR GFP Stable Cell Line |
TU075027 |
ABM |
1.0 ml |
EUR 2333 |
Syt7 3'UTR GFP Stable Cell Line |
TU271494 |
ABM |
1.0 ml |
Ask for price |
SYT7 Rabbit Polyclonal Antibody