SYT7 Rabbit Polyclonal Antibody

SYT7 Polyclonal Antibody
ABP60578-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYT7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT7 from Human, Mouse. This SYT7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT7 protein

SYT7 Polyclonal Antibody
ES10337-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SYT7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT7 Polyclonal Antibody
ES10337-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT7 Rabbit pAb
A12757-100ul 100 ul
EUR 308

SYT7 Rabbit pAb
A12757-200ul 200 ul
EUR 459

SYT7 Rabbit pAb
A12757-20ul 20 ul
EUR 183

SYT7 Rabbit pAb
A12757-50ul 50 ul
EUR 223

SYT7 Antibody
35938-100ul 100ul
EUR 252

SYT7 Antibody
1-CSB-PA120806
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT7. Recognizes SYT7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

SYT7 Antibody
1-CSB-PA592388
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT7. Recognizes SYT7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:15-1:50

Polyclonal Syt7 Antibody (internal region)
APR13660G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Syt7 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal SYT7 antibody - C-terminal region
APR13661G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT7 - C-terminal region. This antibody is tested and proven to work in the following applications:

SYT7 Conjugated Antibody
C35938 100ul
EUR 397

Anti-SYT7 antibody
STJ114630 100 µl
EUR 277
Description: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-Syt7 antibody
STJ72358 100 µg
EUR 260

Anti-SYT7 antibody
STJ191495 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT7

SYT7 siRNA
20-abx935865
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT7 siRNA
20-abx935866
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
abx027983-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
abx027983-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
20-abx212275
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
20-abx212333
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
abx145710-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin 7 (Syt7) Antibody
abx431984-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Synaptotagmin-7 (Syt7) Antibody
abx445035-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

SYT7 cloning plasmid
CSB-CL023043HU-10ug 10ug
EUR 448
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: ATGTACCGGGACCCGGAGGCGGCCAGCCCAGGGGCGCCCTCGCGCGACGTCCTGCTGGTCTCTGCCATCATCACCGTCAGCCTTAGCGTCACTGTCGTCCTCTGCGGCCTCTGCCACTGGTGTCAGCGCAAACTGGGCAAACGCTACAAGAATTCCTTGGAGACGGTGGGCACGC
  • Show more
Description: A cloning plasmid for the SYT7 gene.

Synaptotagmin-7 (Syt7) Antibody (ALP)
abx442432-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (APC)
abx442713-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (Biotin)
abx442993-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (FITC)
abx443273-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (HRP)
abx443554-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (PerCP)
abx444116-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (RPE)
abx444397-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (Streptavidin)
abx444678-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mouse SYT7 shRNA Plasmid
20-abx974511
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT7 shRNA Plasmid
20-abx955984
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT7 Recombinant Protein (Rat)
RP231998 100 ug Ask for price

SYT7 Recombinant Protein (Human)
RP043903 100 ug Ask for price

SYT7 Recombinant Protein (Mouse)
RP176897 100 ug Ask for price

SYT7 Recombinant Protein (Mouse)
RP176900 100 ug Ask for price

SYT7 Recombinant Protein (Mouse)
RP176903 100 ug Ask for price

Synaptotagmin-7 (Syt7) Antibody (ATTO 390)
abx440184-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 488)
abx440465-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 565)
abx440746-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 594)
abx441027-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 633)
abx441308-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 655)
abx441589-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 680)
abx441870-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 700)
abx442151-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (PE/ATTO 594)
abx443835-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Syt7 ORF Vector (Rat) (pORF)
ORF077334 1.0 ug DNA
EUR 506

SYT7 ORF Vector (Human) (pORF)
ORF014635 1.0 ug DNA
EUR 354

Syt7 ORF Vector (Mouse) (pORF)
ORF058967 1.0 ug DNA
EUR 506

Syt7 ORF Vector (Mouse) (pORF)
ORF058968 1.0 ug DNA
EUR 506

Syt7 ORF Vector (Mouse) (pORF)
ORF058969 1.0 ug DNA
EUR 506

Human Synaptotagmin VII (SYT7)ELISA Kit
201-12-2572 96 tests
EUR 440
  • This Synaptotagmin VII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin 7 (SYT7) ELISA Kit
20-abx258615
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Synaptotagmin- 7, Syt7 ELISA KIT
ELI-18560m 96 Tests
EUR 865

Human Synaptotagmin- 7, SYT7 ELISA KIT
ELI-46284h 96 Tests
EUR 824

Human Synaptotagmin 7 (SYT7) CLIA Kit
20-abx495367
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Syt7 sgRNA CRISPR Lentivector set (Rat)
K6766701 3 x 1.0 ug
EUR 339

Syt7 sgRNA CRISPR Lentivector set (Mouse)
K4447801 3 x 1.0 ug
EUR 339

SYT7 sgRNA CRISPR Lentivector set (Human)
K2323101 3 x 1.0 ug
EUR 339

Human Synaptotagmin VII(SYT7)ELISA Kit
QY-E01187 96T
EUR 361

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
4-SEH077Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Synaptotagmin VII elisa. Alternative names of the recognized antigen: IPCA-7
  • PCANAP7
  • SYT-VII
  • Prostate Cancer Associated Protein 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Synaptotagmin VII (SYT7) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human SYT7 (Synaptotagmin VII)
ELK5374 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Synaptotagmin VII (SYT7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Synaptota
  • Show more
Description: A sandwich ELISA kit for detection of Synaptotagmin VII from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Syt7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6766702 1.0 ug DNA
EUR 154

Syt7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6766703 1.0 ug DNA
EUR 154

Syt7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6766704 1.0 ug DNA
EUR 154

Syt7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4447802 1.0 ug DNA
EUR 154

Syt7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4447803 1.0 ug DNA
EUR 154

Syt7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4447804 1.0 ug DNA
EUR 154

SYT7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2323102 1.0 ug DNA
EUR 154

SYT7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2323103 1.0 ug DNA
EUR 154

SYT7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2323104 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-7 (SYT7)
KTE60438-48T 48T
EUR 332
  • SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-7 (SYT7)
KTE60438-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-7 (SYT7)
KTE60438-96T 96T
EUR 539
  • SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-7 (SYT7)
KTE70308-48T 48T
EUR 332
  • SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-7 (SYT7)
KTE70308-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-7 (SYT7)
KTE70308-96T 96T
EUR 539
  • SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT7 Protein Vector (Rat) (pPB-C-His)
PV309334 500 ng
EUR 603

SYT7 Protein Vector (Rat) (pPB-N-His)
PV309335 500 ng
EUR 603

SYT7 Protein Vector (Rat) (pPM-C-HA)
PV309336 500 ng
EUR 603

SYT7 Protein Vector (Rat) (pPM-C-His)
PV309337 500 ng
EUR 603

SYT7 Protein Vector (Human) (pPB-C-His)
PV058537 500 ng
EUR 481

SYT7 Protein Vector (Human) (pPB-N-His)
PV058538 500 ng
EUR 481

SYT7 Protein Vector (Human) (pPM-C-HA)
PV058539 500 ng
EUR 481

SYT7 Protein Vector (Human) (pPM-C-His)
PV058540 500 ng
EUR 481

SYT7 Protein Vector (Mouse) (pPB-C-His)
PV235866 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPB-N-His)
PV235867 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPM-C-HA)
PV235868 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPM-C-His)
PV235869 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPB-C-His)
PV235870 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPB-N-His)
PV235871 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPM-C-HA)
PV235872 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPM-C-His)
PV235873 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPB-C-His)
PV235874 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPB-N-His)
PV235875 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPM-C-HA)
PV235876 500 ng
EUR 603

SYT7 Protein Vector (Mouse) (pPM-C-His)
PV235877 500 ng
EUR 603

Syt7 3'UTR Luciferase Stable Cell Line
TU120048 1.0 ml Ask for price

Syt7 3'UTR GFP Stable Cell Line
TU170048 1.0 ml Ask for price

Syt7 3'UTR Luciferase Stable Cell Line
TU221494 1.0 ml Ask for price

SYT7 3'UTR GFP Stable Cell Line
TU075027 1.0 ml
EUR 2333

Syt7 3'UTR GFP Stable Cell Line
TU271494 1.0 ml Ask for price

SYT7 Rabbit Polyclonal Antibody