 TIGD4 Polyclonal Antibody |
|
ABP60691-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TIGD4 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TIGD4 from Human, Mouse. This TIGD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIGD4 protein |
TIGD4 Polyclonal Antibody |
|
A66174 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 TIGD4 antibody |
|
70R-2988 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal TIGD4 antibody raised against the N terminal of TIGD4 |
 Tigd4 antibody |
|
70R-9206 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Tigd4 antibody |
 TIGD4 Antibody |
|
46274-100ul |
SAB |
100ul |
EUR 252 |
TIGD4 Antibody |
|
46274-50ul |
SAB |
50ul |
EUR 187 |
TIGD4 Antibody |
|
DF9960 |
Affbiotech |
200ul |
EUR 304 |
|
Description: TIGD4 Antibody detects endogenous levels of total TIGD4. |
TIGD4 Antibody |
|
1-CSB-PA818256LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIGD4. Recognizes TIGD4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 TIGD4 Polyclonal Antibody, HRP Conjugated |
|
A66175 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 TIGD4 Polyclonal Antibody, FITC Conjugated |
|
A66176 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 TIGD4 Polyclonal Antibody, Biotin Conjugated |
|
A66177 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 TIGD4 Conjugated Antibody |
|
C46274 |
SAB |
100ul |
EUR 397 |
) TIGD4 Antibody (HRP) |
|
20-abx308689 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) TIGD4 Antibody (FITC) |
|
20-abx308690 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) TIGD4 Antibody (Biotin) |
|
20-abx308691 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-TIGD4 antibody |
|
STJ191513 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TIGD4 |
 Polyclonal TIGD4 antibody - N-terminal region |
|
APR01157G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIGD4 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 Polyclonal Tigd4 antibody - N-terminal region |
|
APR01158G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tigd4 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 TIGD4 siRNA |
|
20-abx936777 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIGD4 siRNA |
|
20-abx936778 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-TIGD4 |
|
YF-PA22701 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to TIGD4 |
 TIGD4 Antibody, HRP conjugated |
|
1-CSB-PA818256LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIGD4. Recognizes TIGD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 TIGD4 Antibody, FITC conjugated |
|
1-CSB-PA818256LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIGD4. Recognizes TIGD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 TIGD4 Antibody, Biotin conjugated |
|
1-CSB-PA818256LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TIGD4. Recognizes TIGD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Tigd4 Blocking Peptide |
|
33R-5368 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tigd4 antibody, catalog no. 70R-9206 |
 TIGD4 Blocking Peptide |
|
33R-7898 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIGD4 antibody, catalog no. 70R-2988 |
TIGD4 Blocking Peptide |
|
DF9960-BP |
Affbiotech |
1mg |
EUR 195 |
 TIGD4 cloning plasmid |
|
CSB-CL818256HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1539
- Sequence: atggcagaagcttctgtggatgcctcaactctgcctgtaacagtgaagaaaaagaaaagcctatccattgaggaaaagatcgacatcataaatgcagtggaaagtggcaagaaaaaagcagagattgctgctgaatatggaataaagaaaaattcattgtcttctattatgaaga
- Show more
|
|
Description: A cloning plasmid for the TIGD4 gene. |
 Mouse TIGD4 shRNA Plasmid |
|
20-abx983976 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human TIGD4 shRNA Plasmid |
|
20-abx966304 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) TIGD4 Recombinant Protein (Human) |
|
RP031552 |
ABM |
100 ug |
Ask for price |
) TIGD4 Recombinant Protein (Mouse) |
|
RP178730 |
ABM |
100 ug |
Ask for price |
 (pORF)) Tigd4 ORF Vector (Mouse) (pORF) |
|
ORF059578 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) TIGD4 ORF Vector (Human) (pORF) |
|
ORF010518 |
ABM |
1.0 ug DNA |
EUR 95 |
 Antibody) Tigger Transposable Element-Derived Protein 4 (TIGD4) Antibody |
|
20-abx218988 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tigger Transposable Element-Derived Protein 4 (TIGD4) Antibody |
|
20-abx301493 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) TIGD4 sgRNA CRISPR Lentivector set (Human) |
|
K2373901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Tigd4 sgRNA CRISPR Lentivector set (Mouse) |
|
K3895501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) TIGD4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2373902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) TIGD4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2373903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) TIGD4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2373904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Tigd4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3895502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Tigd4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3895503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Tigd4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3895504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) TIGD4 Protein Vector (Human) (pPB-C-His) |
|
PV042069 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) TIGD4 Protein Vector (Human) (pPB-N-His) |
|
PV042070 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) TIGD4 Protein Vector (Human) (pPM-C-HA) |
|
PV042071 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) TIGD4 Protein Vector (Human) (pPM-C-His) |
|
PV042072 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) TIGD4 Protein Vector (Mouse) (pPB-C-His) |
|
PV238310 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TIGD4 Protein Vector (Mouse) (pPB-N-His) |
|
PV238311 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TIGD4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV238312 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TIGD4 Protein Vector (Mouse) (pPM-C-His) |
|
PV238313 |
ABM |
500 ng |
EUR 603 |
 Tigd4 3'UTR GFP Stable Cell Line |
|
TU170491 |
ABM |
1.0 ml |
Ask for price |
 TIGD4 3'UTR GFP Stable Cell Line |
|
TU075581 |
ABM |
1.0 ml |
EUR 1394 |
 Tigd4 3'UTR Luciferase Stable Cell Line |
|
TU120491 |
ABM |
1.0 ml |
Ask for price |
 TIGD4 3'UTR Luciferase Stable Cell Line |
|
TU025581 |
ABM |
1.0 ml |
EUR 1394 |
Tigd4 3'UTR Luciferase Stable Cell Line |
|
TU221888 |
ABM |
1.0 ml |
Ask for price |
Tigd4 3'UTR GFP Stable Cell Line |
|
TU271888 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
TIGD4 Rabbit Polyclonal Antibody
