TRAK1 Polyclonal Antibody |
ABP60749-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein |
TRAK1 Polyclonal Antibody |
ABP60749-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein |
TRAK1 Polyclonal Antibody |
ABP60749-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein |
TRAK1 Polyclonal Antibody |
A68042 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TRAK1 Rabbit pAb |
A15249-100ul |
Abclonal |
100 ul |
EUR 308 |
TRAK1 Rabbit pAb |
A15249-200ul |
Abclonal |
200 ul |
EUR 459 |
TRAK1 Rabbit pAb |
A15249-20ul |
Abclonal |
20 ul |
EUR 183 |
TRAK1 Rabbit pAb |
A15249-50ul |
Abclonal |
50 ul |
EUR 223 |
TRAK1 antibody |
70R-4215 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TRAK1 antibody raised against the middle region of TRAK1 |
TRAK1 antibody |
70R-9271 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TRAK1 antibody |
TRAK1 Antibody |
40166-100ul |
SAB |
100ul |
EUR 252 |
TRAK1 Antibody |
1-CSB-PA891465LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TRAK1 Antibody |
1-CSB-PA999701 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TRAK1 Antibody |
1-CSB-PA634052 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
Polyclonal TRAK1 antibody - middle region |
APR01249G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAK1 - middle region. This antibody is tested and proven to work in the following applications: |
Polyclonal TRAK1 antibody - middle region |
APR01250G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAK1 - middle region. This antibody is tested and proven to work in the following applications: |
TRAK1 Polyclonal Antibody, HRP Conjugated |
A68043 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
TRAK1 Polyclonal Antibody, FITC Conjugated |
A68044 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
TRAK1 Polyclonal Antibody, Biotin Conjugated |
A68045 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Polyclonal Goat Anti-OIP106 / TRAK1 Antibody |
APG00224G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-OIP106 / TRAK1 . This antibody is tested and proven to work in the following applications: |
TRAK1 Conjugated Antibody |
C40166 |
SAB |
100ul |
EUR 397 |
TRAK1 Antibody (HRP) |
20-abx312172 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TRAK1 Antibody (FITC) |
20-abx312173 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TRAK1 Antibody (Biotin) |
20-abx312174 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-TRAK1 antibody |
STJ191519 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRAK1 |
TRAK1 siRNA |
20-abx937924 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRAK1 siRNA |
20-abx937925 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TRAK1 |
YF-PA27505 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to TRAK1 |
TRAK1 Antibody, HRP conjugated |
1-CSB-PA891465LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TRAK1 Antibody, FITC conjugated |
1-CSB-PA891465LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TRAK1 Antibody, Biotin conjugated |
1-CSB-PA891465LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TRAK1 Blocking Peptide |
33R-4044 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAK1 antibody, catalog no. 70R-4215 |
TRAK1 Blocking Peptide |
33R-4220 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAK1 antibody, catalog no. 70R-9271 |
TRAK1 cloning plasmid |
CSB-CL891465HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2067
- Sequence: atgtccctgcgagacaagggcggggaagaagaatgttttgaatacgactgccaggatgaagagaggaagccaacccacaggcagcatgacacccaggacctcttggaagaggttttatgtgctgaaagagttggccagatgactaagacatataatgacatagatgctgtcactc
- Show more
|
Description: A cloning plasmid for the TRAK1 gene. |
Mouse TRAK1 shRNA Plasmid |
20-abx975966 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TRAK1 shRNA Plasmid |
20-abx957861 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Trafficking Kinesin Protein 1 (TRAK1) Antibody |
20-abx312171 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Trafficking Kinesin Protein 1 (TRAK1) Antibody |
20-abx210598 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Trafficking Kinesin Protein 1 (TRAK1) Antibody |
20-abx210599 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Trak1 ORF Vector (Rat) (pORF) |
ORF078176 |
ABM |
1.0 ug DNA |
EUR 506 |
TRAK1 ORF Vector (Human) (pORF) |
ORF010927 |
ABM |
1.0 ug DNA |
EUR 95 |
Trak1 ORF Vector (Mouse) (pORF) |
ORF060293 |
ABM |
1.0 ug DNA |
EUR 506 |
TRAK1 sgRNA CRISPR Lentivector set (Human) |
K2439901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trak1 sgRNA CRISPR Lentivector set (Mouse) |
K3460601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trak1 sgRNA CRISPR Lentivector set (Rat) |
K6172201 |
ABM |
3 x 1.0 ug |
EUR 339 |
TRAK1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2439902 |
ABM |
1.0 ug DNA |
EUR 154 |
TRAK1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2439903 |
ABM |
1.0 ug DNA |
EUR 154 |
TRAK1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2439904 |
ABM |
1.0 ug DNA |
EUR 154 |
Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3460602 |
ABM |
1.0 ug DNA |
EUR 154 |
Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3460603 |
ABM |
1.0 ug DNA |
EUR 154 |
Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3460604 |
ABM |
1.0 ug DNA |
EUR 154 |
Trak1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6172202 |
ABM |
1.0 ug DNA |
EUR 154 |
Trak1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6172203 |
ABM |
1.0 ug DNA |
EUR 154 |
Trak1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6172204 |
ABM |
1.0 ug DNA |
EUR 154 |
TRAK1 Protein Vector (Human) (pPB-C-His) |
PV043705 |
ABM |
500 ng |
EUR 329 |
TRAK1 Protein Vector (Human) (pPB-N-His) |
PV043706 |
ABM |
500 ng |
EUR 329 |
TRAK1 Protein Vector (Human) (pPM-C-HA) |
PV043707 |
ABM |
500 ng |
EUR 329 |
TRAK1 Protein Vector (Human) (pPM-C-His) |
PV043708 |
ABM |
500 ng |
EUR 329 |
TRAK1 Protein Vector (Rat) (pPB-C-His) |
PV312702 |
ABM |
500 ng |
EUR 1191 |
TRAK1 Protein Vector (Rat) (pPB-N-His) |
PV312703 |
ABM |
500 ng |
EUR 1191 |
TRAK1 Protein Vector (Rat) (pPM-C-HA) |
PV312704 |
ABM |
500 ng |
EUR 1191 |
TRAK1 Protein Vector (Rat) (pPM-C-His) |
PV312705 |
ABM |
500 ng |
EUR 1191 |
TRAK1 Protein Vector (Mouse) (pPB-C-His) |
PV241170 |
ABM |
500 ng |
EUR 1065 |
TRAK1 Protein Vector (Mouse) (pPB-N-His) |
PV241171 |
ABM |
500 ng |
EUR 1065 |
TRAK1 Protein Vector (Mouse) (pPM-C-HA) |
PV241172 |
ABM |
500 ng |
EUR 1065 |
TRAK1 Protein Vector (Mouse) (pPM-C-His) |
PV241173 |
ABM |
500 ng |
EUR 1065 |
Trak1 3'UTR GFP Stable Cell Line |
TU171029 |
ABM |
1.0 ml |
Ask for price |
TRAK1 3'UTR GFP Stable Cell Line |
TU076279 |
ABM |
1.0 ml |
EUR 2333 |
Trak1 3'UTR Luciferase Stable Cell Line |
TU121029 |
ABM |
1.0 ml |
Ask for price |
TRAK1 3'UTR Luciferase Stable Cell Line |
TU026279 |
ABM |
1.0 ml |
EUR 2333 |
Trak1 3'UTR Luciferase Stable Cell Line |
TU222382 |
ABM |
1.0 ml |
Ask for price |
Trak1 3'UTR GFP Stable Cell Line |
TU272382 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
TRAK1 Rabbit Polyclonal Antibody