TRAK1 Rabbit Polyclonal Antibody

TRAK1 Polyclonal Antibody

ABP60749-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein

TRAK1 Polyclonal Antibody

ABP60749-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein

TRAK1 Polyclonal Antibody

ABP60749-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein

TRAK1 Polyclonal Antibody

A68042 100 µg
EUR 570.55
Description: fast delivery possible

TRAK1 Rabbit pAb

A15249-100ul 100 ul
EUR 308

TRAK1 Rabbit pAb

A15249-200ul 200 ul
EUR 459

TRAK1 Rabbit pAb

A15249-20ul 20 ul
EUR 183

TRAK1 Rabbit pAb

A15249-50ul 50 ul
EUR 223

TRAK1 antibody

70R-4215 50 ug
EUR 467
Description: Rabbit polyclonal TRAK1 antibody raised against the middle region of TRAK1

TRAK1 antibody

70R-9271 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRAK1 antibody

TRAK1 Antibody

40166-100ul 100ul
EUR 252

TRAK1 Antibody

1-CSB-PA891465LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRAK1 Antibody

1-CSB-PA999701
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRAK1 Antibody

1-CSB-PA634052
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Polyclonal TRAK1 antibody - middle region

APR01249G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAK1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal TRAK1 antibody - middle region

APR01250G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAK1 - middle region. This antibody is tested and proven to work in the following applications:

TRAK1 Polyclonal Antibody, HRP Conjugated

A68043 100 µg
EUR 570.55
Description: reagents widely cited

TRAK1 Polyclonal Antibody, FITC Conjugated

A68044 100 µg
EUR 570.55
Description: Ask the seller for details

TRAK1 Polyclonal Antibody, Biotin Conjugated

A68045 100 µg
EUR 570.55
Description: The best epigenetics products

Polyclonal Goat Anti-OIP106 / TRAK1 Antibody

APG00224G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-OIP106 / TRAK1 . This antibody is tested and proven to work in the following applications:

TRAK1 Conjugated Antibody

C40166 100ul
EUR 397

TRAK1 Antibody (HRP)

20-abx312172
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRAK1 Antibody (FITC)

20-abx312173
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRAK1 Antibody (Biotin)

20-abx312174
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-TRAK1 antibody

STJ117443 100 µl
EUR 277

Anti-TRAK1 antibody

STJ191519 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRAK1

TRAK1 siRNA

20-abx937924
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRAK1 siRNA

20-abx937925
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRAK1

YF-PA27505 50 ul
EUR 363
Description: Mouse polyclonal to TRAK1

TRAK1 Antibody, HRP conjugated

1-CSB-PA891465LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRAK1 Antibody, FITC conjugated

1-CSB-PA891465LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRAK1 Antibody, Biotin conjugated

1-CSB-PA891465LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-OIP106 / TRAK1 antibody

STJ70641 100 µg
EUR 359

TRAK1 Blocking Peptide

33R-4044 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAK1 antibody, catalog no. 70R-4215

TRAK1 Blocking Peptide

33R-4220 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAK1 antibody, catalog no. 70R-9271

TRAK1 cloning plasmid

CSB-CL891465HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2067
  • Sequence: atgtccctgcgagacaagggcggggaagaagaatgttttgaatacgactgccaggatgaagagaggaagccaacccacaggcagcatgacacccaggacctcttggaagaggttttatgtgctgaaagagttggccagatgactaagacatataatgacatagatgctgtcactc
  • Show more
Description: A cloning plasmid for the TRAK1 gene.

Mouse TRAK1 shRNA Plasmid

20-abx975966
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRAK1 shRNA Plasmid

20-abx957861
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Trafficking Kinesin Protein 1 (TRAK1) Antibody

20-abx312171
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Trafficking Kinesin Protein 1 (TRAK1) Antibody

20-abx210598
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Trafficking Kinesin Protein 1 (TRAK1) Antibody

20-abx210599
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Trak1 ORF Vector (Rat) (pORF)

ORF078176 1.0 ug DNA
EUR 506

TRAK1 ORF Vector (Human) (pORF)

ORF010927 1.0 ug DNA
EUR 95

Trak1 ORF Vector (Mouse) (pORF)

ORF060293 1.0 ug DNA
EUR 506

TRAK1 sgRNA CRISPR Lentivector set (Human)

K2439901 3 x 1.0 ug
EUR 339

Trak1 sgRNA CRISPR Lentivector set (Mouse)

K3460601 3 x 1.0 ug
EUR 339

Trak1 sgRNA CRISPR Lentivector set (Rat)

K6172201 3 x 1.0 ug
EUR 339

TRAK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2439902 1.0 ug DNA
EUR 154

TRAK1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2439903 1.0 ug DNA
EUR 154

TRAK1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2439904 1.0 ug DNA
EUR 154

Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3460602 1.0 ug DNA
EUR 154

Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3460603 1.0 ug DNA
EUR 154

Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3460604 1.0 ug DNA
EUR 154

Trak1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6172202 1.0 ug DNA
EUR 154

Trak1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6172203 1.0 ug DNA
EUR 154

Trak1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6172204 1.0 ug DNA
EUR 154

TRAK1 Protein Vector (Human) (pPB-C-His)

PV043705 500 ng
EUR 329

TRAK1 Protein Vector (Human) (pPB-N-His)

PV043706 500 ng
EUR 329

TRAK1 Protein Vector (Human) (pPM-C-HA)

PV043707 500 ng
EUR 329

TRAK1 Protein Vector (Human) (pPM-C-His)

PV043708 500 ng
EUR 329

TRAK1 Protein Vector (Rat) (pPB-C-His)

PV312702 500 ng
EUR 1191

TRAK1 Protein Vector (Rat) (pPB-N-His)

PV312703 500 ng
EUR 1191

TRAK1 Protein Vector (Rat) (pPM-C-HA)

PV312704 500 ng
EUR 1191

TRAK1 Protein Vector (Rat) (pPM-C-His)

PV312705 500 ng
EUR 1191

TRAK1 Protein Vector (Mouse) (pPB-C-His)

PV241170 500 ng
EUR 1065

TRAK1 Protein Vector (Mouse) (pPB-N-His)

PV241171 500 ng
EUR 1065

TRAK1 Protein Vector (Mouse) (pPM-C-HA)

PV241172 500 ng
EUR 1065

TRAK1 Protein Vector (Mouse) (pPM-C-His)

PV241173 500 ng
EUR 1065

Trak1 3'UTR GFP Stable Cell Line

TU171029 1.0 ml Ask for price

TRAK1 3'UTR GFP Stable Cell Line

TU076279 1.0 ml
EUR 2333

Trak1 3'UTR Luciferase Stable Cell Line

TU121029 1.0 ml Ask for price

TRAK1 3'UTR Luciferase Stable Cell Line

TU026279 1.0 ml
EUR 2333

Trak1 3'UTR Luciferase Stable Cell Line

TU222382 1.0 ml Ask for price

Trak1 3'UTR GFP Stable Cell Line

TU272382 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

TRAK1 Rabbit Polyclonal Antibody