VAT1 Rabbit Polyclonal Antibody

VAT1 Polyclonal Antibody

ABP60872-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein

VAT1 Polyclonal Antibody

ABP60872-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein

VAT1 Polyclonal Antibody

ES10330-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VAT1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VAT1 Polyclonal Antibody

ES10330-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VAT1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VAT1 Polyclonal Conjugated Antibody

C29967 100ul
EUR 397

VAT1 antibody

70R-4508 50 ug
EUR 467
Description: Rabbit polyclonal VAT1 antibody

[KO Validated] VAT1 Rabbit pAb

A17077-100ul 100 ul
EUR 308

[KO Validated] VAT1 Rabbit pAb

A17077-200ul 200 ul
EUR 459

[KO Validated] VAT1 Rabbit pAb

A17077-20ul 20 ul
EUR 183

[KO Validated] VAT1 Rabbit pAb

A17077-50ul 50 ul
EUR 223

anti- VAT1 antibody

FNab09376 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: vesicle amine transport protein 1 homolog
  • Uniprot ID: Q99536
  • Gene ID: 10493
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against VAT1

Anti-VAT1 antibody

PAab09376 100 ug
EUR 386

Anti-VAT1 antibody

STJ119334 100 µl
EUR 277

Anti-VAT1 antibody

STJ191488 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VAT1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25592 50 ul
EUR 334
Description: Mouse polyclonal to VAT1

VAT1 Blocking Peptide

33R-7240 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VAT1 antibody, catalog no. 70R-4508

VAT1 cloning plasmid

CSB-CL857863HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgtccgacgagagagaggtagccgaggcagcgaccggggaagacgcctcttcgccgcctccgaaaaccgaggcagcgagcgacccccagcatcccgcggcctccgaaggggccgccgccgccgccgcctcgccgccactgctgcgctgcctagtgctcaccggctttggaggct
  • Show more
Description: A cloning plasmid for the VAT1 gene.


PVT13215 2 ug
EUR 391

Anti-VAT1 (3E9)

YF-MA17337 100 ug
EUR 363
Description: Mouse monoclonal to VAT1

VAT1 protein (His tag)

80R-2081 50 ug
EUR 424
Description: Recombinant human VAT1 protein (His tag)

Mouse Vat1 ELISA KIT

ELI-16858m 96 Tests
EUR 865


EF004179 96 Tests
EUR 689

Rat VAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-39842h 96 Tests
EUR 824

VAT1 Recombinant Protein (Rat)

RP236288 100 ug Ask for price

VAT1 Recombinant Protein (Human)

RP034264 100 ug Ask for price

VAT1 Recombinant Protein (Mouse)

RP183662 100 ug Ask for price

Vat1 ORF Vector (Mouse) (pORF)

ORF061222 1.0 ug DNA
EUR 506

Vat1 ORF Vector (Rat) (pORF)

ORF078764 1.0 ug DNA
EUR 506

VAT1 ORF Vector (Human) (pORF)

ORF011422 1.0 ug DNA
EUR 95

VAT1 ELISA Kit (Human) (OKEH08378)

OKEH08378 96 Wells
EUR 896
Description: Description of target: Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. The protein encoded by this gene is an abundant integral membrane protein of cholinergic synaptic vesicles and is thought to be involved in vesicular transport. It belongs to the quinone oxidoreductase subfamily of zinc-containing alcohol dehydrogenase proteins.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Vat1 sgRNA CRISPR Lentivector set (Mouse)

K4763801 3 x 1.0 ug
EUR 339

Vat1 sgRNA CRISPR Lentivector set (Rat)

K7470001 3 x 1.0 ug
EUR 339

VAT1 sgRNA CRISPR Lentivector set (Human)

K2606101 3 x 1.0 ug
EUR 339

Synaptic Vesicle Membrane Protein VAT-1 Homolog (VAT1) Antibody

abx239376-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4763802 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4763803 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4763804 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7470002 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7470003 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7470004 1.0 ug DNA
EUR 154

VAT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2606102 1.0 ug DNA
EUR 154

VAT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2606103 1.0 ug DNA
EUR 154

VAT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2606104 1.0 ug DNA
EUR 154

VAT1 Protein Vector (Mouse) (pPB-C-His)

PV244886 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPB-N-His)

PV244887 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPM-C-HA)

PV244888 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPM-C-His)

PV244889 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPB-C-His)

PV315054 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPB-N-His)

PV315055 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPM-C-HA)

PV315056 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPM-C-His)

PV315057 500 ng
EUR 603

VAT1 Protein Vector (Human) (pPB-C-His)

PV045685 500 ng
EUR 329

VAT1 Protein Vector (Human) (pPB-N-His)

PV045686 500 ng
EUR 329

VAT1 Protein Vector (Human) (pPM-C-HA)

PV045687 500 ng
EUR 329

VAT1 Protein Vector (Human) (pPM-C-His)

PV045688 500 ng
EUR 329

Recombinant Human VAT1 Protein, His, E.coli-10ug

QP13926-10ug 10ug
EUR 201

Recombinant Human VAT1 Protein, His, E.coli-1mg

QP13926-1mg 1mg
EUR 5251

Recombinant Human VAT1 Protein, His, E.coli-2ug

QP13926-2ug 2ug
EUR 155

Vat1 3'UTR Luciferase Stable Cell Line

TU121734 1.0 ml Ask for price

VAT1 3'UTR GFP Stable Cell Line

TU078058 1.0 ml
EUR 1394

Vat1 3'UTR GFP Stable Cell Line

TU171734 1.0 ml Ask for price

Vat1 3'UTR Luciferase Stable Cell Line

TU223008 1.0 ml Ask for price

VAT1 3'UTR Luciferase Stable Cell Line

TU028058 1.0 ml
EUR 1394

Vat1 3'UTR GFP Stable Cell Line

TU273008 1.0 ml Ask for price

VAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV637531 1.0 ug DNA
EUR 682

VAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV637535 1.0 ug DNA
EUR 682

VAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV637536 1.0 ug DNA
EUR 682

VAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV793219 1.0 ug DNA
EUR 316

VAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV793220 1.0 ug DNA
EUR 316

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VAT1 Rabbit Polyclonal Antibody