Biocat Net

Amine biocat 3.0

VAT1 Rabbit Polyclonal Antibody

VAT1 Polyclonal Antibody

ABP60872-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein

VAT1 Polyclonal Antibody

ABP60872-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein

VAT1 Polyclonal Antibody

29967-100ul 100ul
EUR 252

VAT1 Polyclonal Antibody

29967-50ul 50ul
EUR 187

VAT1 Polyclonal Conjugated Antibody

C29967 100ul
EUR 397

VAT1 antibody

70R-4508 50 ug
EUR 467
Description: Rabbit polyclonal VAT1 antibody

[KO Validated] VAT1 Rabbit pAb

A17077-100ul 100 ul
EUR 308

[KO Validated] VAT1 Rabbit pAb

A17077-200ul 200 ul
EUR 459

[KO Validated] VAT1 Rabbit pAb

A17077-20ul 20 ul
EUR 183

[KO Validated] VAT1 Rabbit pAb

A17077-50ul 50 ul
EUR 223

anti- VAT1 antibody

FNab09376 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: vesicle amine transport protein 1 homolog
  • Uniprot ID: Q99536
  • Gene ID: 10493
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against VAT1

Anti-VAT1 antibody

PAab09376 100 ug
EUR 386

Anti-VAT1 antibody

STJ119334 100 µl
EUR 277

Anti-VAT1 antibody

STJ191488 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VAT1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25592 50 ul
EUR 334
Description: Mouse polyclonal to VAT1

VAT1 Blocking Peptide

33R-7240 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VAT1 antibody, catalog no. 70R-4508

VAT1 cloning plasmid

CSB-CL857863HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgtccgacgagagagaggtagccgaggcagcgaccggggaagacgcctcttcgccgcctccgaaaaccgaggcagcgagcgacccccagcatcccgcggcctccgaaggggccgccgccgccgccgcctcgccgccactgctgcgctgcctagtgctcaccggctttggaggct
  • Show more
Description: A cloning plasmid for the VAT1 gene.


PVT13215 2 ug
EUR 391

Anti-VAT1 (3E9)

YF-MA17337 100 ug
EUR 363
Description: Mouse monoclonal to VAT1

Mouse VAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat VAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Vat1 ELISA KIT

ELI-16858m 96 Tests
EUR 865


EF004179 96 Tests
EUR 689


ELI-39842h 96 Tests
EUR 824

Human VAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VAT1 protein (His tag)

80R-2081 50 ug
EUR 424
Description: Recombinant human VAT1 protein (His tag)

VAT1 Recombinant Protein (Human)

RP034264 100 ug Ask for price

VAT1 Recombinant Protein (Rat)

RP236288 100 ug Ask for price

VAT1 Recombinant Protein (Mouse)

RP183662 100 ug Ask for price

Vat1 ORF Vector (Rat) (pORF)

ORF078764 1.0 ug DNA
EUR 506

VAT1 ORF Vector (Human) (pORF)

ORF011422 1.0 ug DNA
EUR 95

Vat1 ORF Vector (Mouse) (pORF)

ORF061222 1.0 ug DNA
EUR 506

VAT1 ELISA Kit (Human) (OKEH08378)

OKEH08378 96 Wells
EUR 896
Description: Description of target: Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. The protein encoded by this gene is an abundant integral membrane protein of cholinergic synaptic vesicles and is thought to be involved in vesicular transport. It belongs to the quinone oxidoreductase subfamily of zinc-containing alcohol dehydrogenase proteins.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

VAT1 sgRNA CRISPR Lentivector set (Human)

K2606101 3 x 1.0 ug
EUR 339

Vat1 sgRNA CRISPR Lentivector set (Mouse)

K4763801 3 x 1.0 ug
EUR 339

Vat1 sgRNA CRISPR Lentivector set (Rat)

K7470001 3 x 1.0 ug
EUR 339

Synaptic Vesicle Membrane Protein VAT-1 Homolog (VAT1) Antibody

abx239376-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

VAT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2606102 1.0 ug DNA
EUR 154

VAT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2606103 1.0 ug DNA
EUR 154

VAT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2606104 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4763802 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4763803 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4763804 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7470002 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7470003 1.0 ug DNA
EUR 154

Vat1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7470004 1.0 ug DNA
EUR 154

VAT1 Protein Vector (Human) (pPB-C-His)

PV045685 500 ng
EUR 329

VAT1 Protein Vector (Human) (pPB-N-His)

PV045686 500 ng
EUR 329

VAT1 Protein Vector (Human) (pPM-C-HA)

PV045687 500 ng
EUR 329

VAT1 Protein Vector (Human) (pPM-C-His)

PV045688 500 ng
EUR 329

Recombinant Human VAT1 Protein, His, E.coli-10ug

QP13926-10ug 10ug
EUR 201

Recombinant Human VAT1 Protein, His, E.coli-1mg

QP13926-1mg 1mg
EUR 5251

Recombinant Human VAT1 Protein, His, E.coli-2ug

QP13926-2ug 2ug
EUR 155

VAT1 Protein Vector (Rat) (pPB-C-His)

PV315054 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPB-N-His)

PV315055 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPM-C-HA)

PV315056 500 ng
EUR 603

VAT1 Protein Vector (Rat) (pPM-C-His)

PV315057 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPB-C-His)

PV244886 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPB-N-His)

PV244887 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPM-C-HA)

PV244888 500 ng
EUR 603

VAT1 Protein Vector (Mouse) (pPM-C-His)

PV244889 500 ng
EUR 603

Vat1 3'UTR GFP Stable Cell Line

TU171734 1.0 ml Ask for price

VAT1 3'UTR GFP Stable Cell Line

TU078058 1.0 ml
EUR 1394

Vat1 3'UTR Luciferase Stable Cell Line

TU121734 1.0 ml Ask for price

VAT1 3'UTR Luciferase Stable Cell Line

TU028058 1.0 ml
EUR 1394

Vat1 3'UTR Luciferase Stable Cell Line

TU223008 1.0 ml Ask for price

Vat1 3'UTR GFP Stable Cell Line

TU273008 1.0 ml Ask for price

VAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV637531 1.0 ug DNA
EUR 682

VAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV637535 1.0 ug DNA
EUR 682

VAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV637536 1.0 ug DNA
EUR 682

VAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV793219 1.0 ug DNA
EUR 316

VAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV793220 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

VAT1 Rabbit Polyclonal Antibody