 VAT1 Polyclonal Antibody |
|
ABP60872-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein |
VAT1 Polyclonal Antibody |
|
ABP60872-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein |
VAT1 Polyclonal Antibody |
|
29967-100ul |
SAB |
100ul |
EUR 252 |
VAT1 Polyclonal Antibody |
|
29967-50ul |
SAB |
50ul |
EUR 187 |
 VAT1 Polyclonal Conjugated Antibody |
|
C29967 |
SAB |
100ul |
EUR 397 |
 VAT1 antibody |
|
70R-4508 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal VAT1 antibody |
 [KO Validated] VAT1 Rabbit pAb |
|
A17077-100ul |
Abclonal |
100 ul |
EUR 308 |
[KO Validated] VAT1 Rabbit pAb |
|
A17077-200ul |
Abclonal |
200 ul |
EUR 459 |
[KO Validated] VAT1 Rabbit pAb |
|
A17077-20ul |
Abclonal |
20 ul |
EUR 183 |
[KO Validated] VAT1 Rabbit pAb |
|
A17077-50ul |
Abclonal |
50 ul |
EUR 223 |
 anti- VAT1 antibody |
|
FNab09376 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:1000-1:10000
- IHC: 1:20-1:200
- Immunogen: vesicle amine transport protein 1 homolog
- Uniprot ID: Q99536
- Gene ID: 10493
- Research Area: Metabolism, Developmental biology
|
|
Description: Antibody raised against VAT1 |
 Anti-VAT1 antibody |
|
STJ191488 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to VAT1 |
 VAT1 siRNA |
|
20-abx906008 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VAT1 siRNA |
|
20-abx939346 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VAT1 siRNA |
|
20-abx939347 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-VAT1 |
|
YF-PA25592 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to VAT1 |
 VAT1 Blocking Peptide |
|
33R-7240 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VAT1 antibody, catalog no. 70R-4508 |
 VAT1 cloning plasmid |
|
CSB-CL857863HU-10ug |
Cusabio |
10ug |
EUR 440 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1182
- Sequence: atgtccgacgagagagaggtagccgaggcagcgaccggggaagacgcctcttcgccgcctccgaaaaccgaggcagcgagcgacccccagcatcccgcggcctccgaaggggccgccgccgccgccgcctcgccgccactgctgcgctgcctagtgctcaccggctttggaggct
- Show more
|
|
Description: A cloning plasmid for the VAT1 gene. |
) Anti-VAT1 (3E9) |
|
YF-MA17337 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to VAT1 |
 Mouse VAT1 shRNA Plasmid |
|
20-abx973802 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat VAT1 shRNA Plasmid |
|
20-abx988270 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human VAT1 shRNA Plasmid |
|
20-abx957130 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) VAT1 protein (His tag) |
|
80R-2081 |
Fitzgerald |
50 ug |
EUR 424 |
|
Description: Recombinant human VAT1 protein (His tag) |
) VAT1 Recombinant Protein (Human) |
|
RP034264 |
ABM |
100 ug |
Ask for price |
) VAT1 Recombinant Protein (Rat) |
|
RP236288 |
ABM |
100 ug |
Ask for price |
) VAT1 Recombinant Protein (Mouse) |
|
RP183662 |
ABM |
100 ug |
Ask for price |
 (pORF)) Vat1 ORF Vector (Rat) (pORF) |
|
ORF078764 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) VAT1 ORF Vector (Human) (pORF) |
|
ORF011422 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Vat1 ORF Vector (Mouse) (pORF) |
|
ORF061222 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEH08378)) VAT1 ELISA Kit (Human) (OKEH08378) |
|
OKEH08378 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. The protein encoded by this gene is an abundant integral membrane protein of cholinergic synaptic vesicles and is thought to be involved in vesicular transport. It belongs to the quinone oxidoreductase subfamily of zinc-containing alcohol dehydrogenase proteins.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
) VAT1 sgRNA CRISPR Lentivector set (Human) |
|
K2606101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Vat1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4763801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Vat1 sgRNA CRISPR Lentivector set (Rat) |
|
K7470001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Synaptic Vesicle Membrane Protein VAT-1 Homolog (VAT1) Antibody |
|
abx239376-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (Target 1)) VAT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2606102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) VAT1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2606103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) VAT1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2606104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4763802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4763803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4763804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Vat1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7470002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vat1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7470003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vat1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7470004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) VAT1 Protein Vector (Human) (pPB-C-His) |
|
PV045685 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) VAT1 Protein Vector (Human) (pPB-N-His) |
|
PV045686 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) VAT1 Protein Vector (Human) (pPM-C-HA) |
|
PV045687 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) VAT1 Protein Vector (Human) (pPM-C-His) |
|
PV045688 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human VAT1 Protein, His, E.coli-10ug |
|
QP13926-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human VAT1 Protein, His, E.coli-1mg |
|
QP13926-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human VAT1 Protein, His, E.coli-2ug |
|
QP13926-2ug |
EnQuireBio |
2ug |
EUR 155 |
 (pPB-C-His)) VAT1 Protein Vector (Rat) (pPB-C-His) |
|
PV315054 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) VAT1 Protein Vector (Rat) (pPB-N-His) |
|
PV315055 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) VAT1 Protein Vector (Rat) (pPM-C-HA) |
|
PV315056 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) VAT1 Protein Vector (Rat) (pPM-C-His) |
|
PV315057 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) VAT1 Protein Vector (Mouse) (pPB-C-His) |
|
PV244886 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) VAT1 Protein Vector (Mouse) (pPB-N-His) |
|
PV244887 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) VAT1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV244888 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) VAT1 Protein Vector (Mouse) (pPM-C-His) |
|
PV244889 |
ABM |
500 ng |
EUR 603 |
 Vat1 3'UTR GFP Stable Cell Line |
|
TU171734 |
ABM |
1.0 ml |
Ask for price |
 VAT1 3'UTR GFP Stable Cell Line |
|
TU078058 |
ABM |
1.0 ml |
EUR 1394 |
 Vat1 3'UTR Luciferase Stable Cell Line |
|
TU121734 |
ABM |
1.0 ml |
Ask for price |
 VAT1 3'UTR Luciferase Stable Cell Line |
|
TU028058 |
ABM |
1.0 ml |
EUR 1394 |
Vat1 3'UTR Luciferase Stable Cell Line |
|
TU223008 |
ABM |
1.0 ml |
Ask for price |
Vat1 3'UTR GFP Stable Cell Line |
|
TU273008 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) VAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV637531 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) VAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV637535 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) VAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV637536 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) VAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV793219 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) VAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV793220 |
ABM |
1.0 ug DNA |
EUR 316 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
VAT1 Rabbit Polyclonal Antibody
