VGLL2 Polyclonal Antibody |
ABP60888-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VGLL2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VGLL2 from Human, Mouse. This VGLL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VGLL2 protein |
VGLL2 Polyclonal Antibody |
ABP60888-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VGLL2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VGLL2 from Human, Mouse. This VGLL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VGLL2 protein |
VGLL2 Polyclonal Antibody |
ABP60888-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VGLL2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VGLL2 from Human, Mouse. This VGLL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VGLL2 protein |
VGLL2 Polyclonal Antibody |
A66498 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Vgll2 antibody |
70R-9003 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Vgll2 antibody |
VGLL2 Antibody |
39962-100ul |
SAB |
100ul |
EUR 390 |
VGLL2 Antibody |
43898-100ul |
SAB |
100ul |
EUR 252 |
VGLL2 Antibody |
DF2251 |
Affbiotech |
200ul |
EUR 304 |
Description: VGLL2 antibody detects endogenous levels of total VGLL2. |
VGLL2 Antibody |
1-CSB-PA836691LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VGLL2. Recognizes VGLL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal VGLL2 Antibody (N-term) |
APR03484G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VGLL2 (N-term). This antibody is tested and proven to work in the following applications: |
VGLL2 Polyclonal Antibody, HRP Conjugated |
A66499 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
VGLL2 Polyclonal Antibody, FITC Conjugated |
A66500 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
VGLL2 Polyclonal Antibody, Biotin Conjugated |
A66501 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Polyclonal Vgll2 antibody - C-terminal region |
APR00713G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vgll2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal Vgll2 Antibody - C-terminal region |
APR00722G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vgll2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal Vgll2 antibody - N-terminal region |
APR01108G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vgll2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
VGLL2 Conjugated Antibody |
C43898 |
SAB |
100ul |
EUR 397 |
VGLL2 Antibody (HRP) |
20-abx309214 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VGLL2 Antibody (FITC) |
20-abx309215 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VGLL2 Antibody (Biotin) |
20-abx309216 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-VGLL2 Antibody |
A1188-100 |
Biovision |
|
EUR 370 |
Anti-VGLL2 Antibody |
A1616-100 |
Biovision |
|
EUR 370 |
Anti-VGLL2 antibody |
STJ191523 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VGLL2 |
VGLL2 siRNA |
20-abx939404 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VGLL2 siRNA |
20-abx939405 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-VGLL2 |
YF-PA22782 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to VGLL2 |
anti-VGLL2 |
YF-PA22783 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to VGLL2 |
VGLL2 Antibody, HRP conjugated |
1-CSB-PA836691LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VGLL2. Recognizes VGLL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VGLL2 Antibody, FITC conjugated |
1-CSB-PA836691LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VGLL2. Recognizes VGLL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VGLL2 Antibody, Biotin conjugated |
1-CSB-PA836691LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VGLL2. Recognizes VGLL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Vgll2 Blocking Peptide |
33R-8492 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vgll2 antibody, catalog no. 70R-9003 |
VGLL2 Blocking Peptide |
DF2251-BP |
Affbiotech |
1mg |
EUR 195 |
VGLL2 cloning plasmid |
CSB-CL836691HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 432
- Sequence: atgagctgtctggatgttatgtaccaagtctatggtcctccgcagccctacttcgcagccgcctacaccccctaccaccagaaactagcctattattccaaaatgcaggaagcgcaggagtgcaatgccagccccagcagcagtggcagcggcagctcctcattttccagccaaac
- Show more
|
Description: A cloning plasmid for the VGLL2 gene. |
Mouse VGLL2 shRNA Plasmid |
20-abx980909 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VGLL2 shRNA Plasmid |
20-abx966593 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VGLL2 Recombinant Protein (Human) |
RP034318 |
ABM |
100 ug |
Ask for price |
VGLL2 Recombinant Protein (Rat) |
RP236384 |
ABM |
100 ug |
Ask for price |
VGLL2 Recombinant Protein (Mouse) |
RP183782 |
ABM |
100 ug |
Ask for price |
Vgll2 ORF Vector (Rat) (pORF) |
ORF078796 |
ABM |
1.0 ug DNA |
EUR 506 |
VGLL2 ORF Vector (Human) (pORF) |
ORF011440 |
ABM |
1.0 ug DNA |
EUR 95 |
Vgll2 ORF Vector (Mouse) (pORF) |
ORF061262 |
ABM |
1.0 ug DNA |
EUR 506 |
Transcription Cofactor Vestigial-Like Protein 2 (VGLL2) Antibody |
abx037049-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Transcription Cofactor Vestigial-Like Protein 2 (VGLL2) Antibody |
abx025933-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transcription Cofactor Vestigial-Like Protein 2 (VGLL2) Antibody |
abx025933-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transcription Cofactor Vestigial-Like Protein 2 (VGLL2) Antibody |
20-abx309213 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VGLL2 sgRNA CRISPR Lentivector set (Human) |
K2611001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vgll2 sgRNA CRISPR Lentivector set (Mouse) |
K3752201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vgll2 sgRNA CRISPR Lentivector set (Rat) |
K6329001 |
ABM |
3 x 1.0 ug |
EUR 339 |
VGLL2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2611002 |
ABM |
1.0 ug DNA |
EUR 154 |
VGLL2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2611003 |
ABM |
1.0 ug DNA |
EUR 154 |
VGLL2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2611004 |
ABM |
1.0 ug DNA |
EUR 154 |
Vgll2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3752202 |
ABM |
1.0 ug DNA |
EUR 154 |
Vgll2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3752203 |
ABM |
1.0 ug DNA |
EUR 154 |
Vgll2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3752204 |
ABM |
1.0 ug DNA |
EUR 154 |
Vgll2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6329002 |
ABM |
1.0 ug DNA |
EUR 154 |
Vgll2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6329003 |
ABM |
1.0 ug DNA |
EUR 154 |
Vgll2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6329004 |
ABM |
1.0 ug DNA |
EUR 154 |
VGLL2 Protein Vector (Human) (pPB-C-His) |
PV045757 |
ABM |
500 ng |
EUR 329 |
VGLL2 Protein Vector (Human) (pPB-N-His) |
PV045758 |
ABM |
500 ng |
EUR 329 |
VGLL2 Protein Vector (Human) (pPM-C-HA) |
PV045759 |
ABM |
500 ng |
EUR 329 |
VGLL2 Protein Vector (Human) (pPM-C-His) |
PV045760 |
ABM |
500 ng |
EUR 329 |
VGLL2 Protein Vector (Rat) (pPB-C-His) |
PV315182 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Rat) (pPB-N-His) |
PV315183 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Rat) (pPM-C-HA) |
PV315184 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Rat) (pPM-C-His) |
PV315185 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Mouse) (pPB-C-His) |
PV245046 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Mouse) (pPB-N-His) |
PV245047 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Mouse) (pPM-C-HA) |
PV245048 |
ABM |
500 ng |
EUR 603 |
VGLL2 Protein Vector (Mouse) (pPM-C-His) |
PV245049 |
ABM |
500 ng |
EUR 603 |
Vgll2 3'UTR GFP Stable Cell Line |
TU171759 |
ABM |
1.0 ml |
Ask for price |
VGLL2 3'UTR GFP Stable Cell Line |
TU078114 |
ABM |
1.0 ml |
EUR 1394 |
Vgll2 3'UTR Luciferase Stable Cell Line |
TU121759 |
ABM |
1.0 ml |
Ask for price |
VGLL2 3'UTR Luciferase Stable Cell Line |
TU028114 |
ABM |
1.0 ml |
EUR 1394 |
Vgll2 3'UTR Luciferase Stable Cell Line |
TU223035 |
ABM |
1.0 ml |
Ask for price |
Vgll2 3'UTR GFP Stable Cell Line |
TU273035 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VGLL2 Rabbit Polyclonal Antibody