Biocat Net

Amine biocat 3.0

YSK4 Rabbit Polyclonal Antibody

YSK4 Polyclonal Antibody

ABP60945-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human YSK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of YSK4 from Human. This YSK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YSK4 protein

YSK4 Polyclonal Antibody

ABP60945-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human YSK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of YSK4 from Human. This YSK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YSK4 protein

YSK4 Polyclonal Antibody

ABP60945-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human YSK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of YSK4 from Human. This YSK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YSK4 protein

Anti-YSK4 antibody

STJ191471 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to YSK4

SPS1/STE20-Related Protein Kinase YSK4 (YSK4) Antibody

abx036782-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.


YF-PA21006 50 ug
EUR 363
Description: Mouse polyclonal to YSK4

Antibody for Human YSK4

SPC-1216D 0.1ml
EUR 354
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is unconjugated.

Antibody for Human YSK4

SPC-1216D-A390 0.1ml
EUR 401
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 390.

Antibody for Human YSK4

SPC-1216D-A488 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 488.

Antibody for Human YSK4

SPC-1216D-A565 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 565.

Antibody for Human YSK4

SPC-1216D-A594 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 594.

Antibody for Human YSK4

SPC-1216D-A633 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 633.

Antibody for Human YSK4

SPC-1216D-A655 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 655.

Antibody for Human YSK4

SPC-1216D-A680 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 680.

Antibody for Human YSK4

SPC-1216D-A700 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 700.

Antibody for Human YSK4

SPC-1216D-ALP 0.1ml
EUR 394
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human YSK4

SPC-1216D-APC 0.1ml
EUR 399
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC .

Antibody for Human YSK4

SPC-1216D-APCCY7 0.1ml
EUR 471
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC/Cy7.

Antibody for Human YSK4

SPC-1216D-BI 0.1ml
EUR 396
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Biotin.

Antibody for Human YSK4

SPC-1216D-DY350 0.1ml
EUR 475
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 350.

Antibody for Human YSK4

SPC-1216D-DY405 0.1ml
EUR 452
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 405.

Antibody for Human YSK4

SPC-1216D-DY488 0.1ml
EUR 432
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 488.

Antibody for Human YSK4

SPC-1216D-DY594 0.1ml
EUR 436
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 594.

Antibody for Human YSK4

SPC-1216D-DY633 0.1ml
EUR 426
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 633.

Antibody for Human YSK4

SPC-1216D-FITC 0.1ml
EUR 392
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to FITC.

Antibody for Human YSK4

SPC-1216D-HRP 0.1ml
EUR 388
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to HRP.

Antibody for Human YSK4

SPC-1216D-P594 0.1ml
EUR 407
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PE/ATTO 594.

Antibody for Human YSK4

SPC-1216D-PCP 0.1ml
EUR 399
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PerCP.

Antibody for Human YSK4

SPC-1216D-RPE 0.1ml
EUR 397
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to RPE .

Antibody for Human YSK4

SPC-1216D-STR 0.1ml
EUR 398
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Streptavidin.

Antibody for Human YSK4

SPC-1217D 0.1ml
EUR 354
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is unconjugated.

Antibody for Human YSK4

SPC-1217D-A390 0.1ml
EUR 401
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 390.

Antibody for Human YSK4

SPC-1217D-A488 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 488.

Antibody for Human YSK4

SPC-1217D-A565 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 565.

Antibody for Human YSK4

SPC-1217D-A594 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 594.

Antibody for Human YSK4

SPC-1217D-A633 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 633.

Antibody for Human YSK4

SPC-1217D-A655 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 655.

Antibody for Human YSK4

SPC-1217D-A680 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 680.

Antibody for Human YSK4

SPC-1217D-A700 0.1ml
EUR 400
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 700.

Antibody for Human YSK4

SPC-1217D-ALP 0.1ml
EUR 394
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human YSK4

SPC-1217D-APC 0.1ml
EUR 399
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC .

Antibody for Human YSK4

SPC-1217D-APCCY7 0.1ml
EUR 471
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC/Cy7.

Antibody for Human YSK4

SPC-1217D-BI 0.1ml
EUR 396
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Biotin.

Antibody for Human YSK4

SPC-1217D-DY350 0.1ml
EUR 475
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 350.

Antibody for Human YSK4

SPC-1217D-DY405 0.1ml
EUR 452
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 405.

Antibody for Human YSK4

SPC-1217D-DY488 0.1ml
EUR 432
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 488.

Antibody for Human YSK4

SPC-1217D-DY594 0.1ml
EUR 436
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 594.

Antibody for Human YSK4

SPC-1217D-DY633 0.1ml
EUR 426
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 633.

Antibody for Human YSK4

SPC-1217D-FITC 0.1ml
EUR 392
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to FITC.

Antibody for Human YSK4

SPC-1217D-HRP 0.1ml
EUR 388
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to HRP.

Antibody for Human YSK4

SPC-1217D-P594 0.1ml
EUR 407
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PE/ATTO 594.

Antibody for Human YSK4

SPC-1217D-PCP 0.1ml
EUR 399
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PerCP.

Antibody for Human YSK4

SPC-1217D-RPE 0.1ml
EUR 397
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to RPE .

Antibody for Human YSK4

SPC-1217D-STR 0.1ml
EUR 398
  • YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily.
  • Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Streptavidin.

YSK4 cloning plasmid

CSB-CL707114HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 507
  • Sequence: atggagtttgttcctggtggctcaatctctagtattataaaccgttttgggccattgcctgagatggtgttctgtaaatatacgaaacaaatacttcaaggtgttgcttatctccatgagaactgtgtggtacatcgcgatatcaaaggaaataatgttatgctcatgccaactgg
  • Show more
Description: A cloning plasmid for the YSK4 gene.

Anti-YSK4 (2A4)

YF-MA19390 100 ug
EUR 363
Description: Mouse monoclonal to YSK4

Human SPS1/STE20- related protein kinase YSK4, YSK4 ELISA KIT

ELI-28798h 96 Tests
EUR 824

YSK4 ORF Vector (Human) (pORF)

ORF011686 1.0 ug DNA
EUR 95

Ysk4 ORF Vector (Mouse) (pORF)

ORF062027 1.0 ug DNA
EUR 506

YSK4 sgRNA CRISPR Lentivector set (Human)

K2656401 3 x 1.0 ug
EUR 339

Ysk4 sgRNA CRISPR Lentivector set (Mouse)

K3128301 3 x 1.0 ug
EUR 339

YSK4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2656402 1.0 ug DNA
EUR 154

YSK4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2656403 1.0 ug DNA
EUR 154

YSK4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2656404 1.0 ug DNA
EUR 154

Ysk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3128302 1.0 ug DNA
EUR 154

Ysk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3128303 1.0 ug DNA
EUR 154

Ysk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3128304 1.0 ug DNA
EUR 154

YSK4 Protein Vector (Human) (pPB-C-His)

PV046741 500 ng
EUR 329

YSK4 Protein Vector (Human) (pPB-N-His)

PV046742 500 ng
EUR 329

YSK4 Protein Vector (Human) (pPM-C-HA)

PV046743 500 ng
EUR 329

YSK4 Protein Vector (Human) (pPM-C-His)

PV046744 500 ng
EUR 329

YSK4 Protein Vector (Mouse) (pPB-C-His)

PV248106 500 ng
EUR 1065

YSK4 Protein Vector (Mouse) (pPB-N-His)

PV248107 500 ng
EUR 1065

YSK4 Protein Vector (Mouse) (pPM-C-HA)

PV248108 500 ng
EUR 1065

YSK4 Protein Vector (Mouse) (pPM-C-His)

PV248109 500 ng
EUR 1065

Ysk4 3'UTR GFP Stable Cell Line

TU172441 1.0 ml Ask for price

YSK4 3'UTR GFP Stable Cell Line

TU078663 1.0 ml
EUR 1394

Ysk4 3'UTR Luciferase Stable Cell Line

TU122441 1.0 ml Ask for price

YSK4 3'UTR Luciferase Stable Cell Line

TU028663 1.0 ml
EUR 1394

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

YSK4 Rabbit Polyclonal Antibody