 BTF3 Polyclonal Antibody |
|
ABP57929-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200 |
BTF3 Polyclonal Antibody |
|
ABP57929-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200 |
BTF3 Polyclonal Antibody |
|
A51857 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
BTF3 Polyclonal Antibody |
|
28890-100ul |
SAB |
100ul |
EUR 252 |
BTF3 Polyclonal Antibody |
|
28890-50ul |
SAB |
50ul |
EUR 187 |
 BTF3 Rabbit pAb |
|
A15259-100ul |
Abclonal |
100 ul |
EUR 308 |
BTF3 Rabbit pAb |
|
A15259-200ul |
Abclonal |
200 ul |
EUR 459 |
BTF3 Rabbit pAb |
|
A15259-20ul |
Abclonal |
20 ul |
EUR 183 |
BTF3 Rabbit pAb |
|
A15259-50ul |
Abclonal |
50 ul |
EUR 223 |
 BTF3 Polyclonal Conjugated Antibody |
|
C28890 |
SAB |
100ul |
EUR 397 |
 Antibody) Transcription Factor BTF3 (BTF3) Antibody |
|
20-abx110270 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 (BTF3) Antibody |
|
abx026082-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 (BTF3) Antibody |
|
abx026082-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 BTF3 antibody |
|
10R-1391 |
Fitzgerald |
100 ug |
EUR 512 |
|
Description: Mouse monoclonal BTF3 antibody |
BTF3 antibody |
|
20R-1189 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal BTF3 antibody |
BTF3 antibody |
|
70R-15362 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody |
 BTF3 Antibody |
|
1-CSB-PA01714A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 BTF3 Polyclonal Antibody, HRP Conjugated |
|
A51858 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 BTF3 Polyclonal Antibody, FITC Conjugated |
|
A51859 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 BTF3 Polyclonal Antibody, Biotin Conjugated |
|
A51860 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Antibody Pair) Transcription Factor BTF3 (BTF3) Antibody Pair |
|
abx117418-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Transcription Factor BTF3 (BTF3) Antibody (HRP) |
|
20-abx108815 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Transcription Factor BTF3 (BTF3) Antibody (Biotin) |
|
20-abx105980 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Transcription Factor BTF3 (BTF3) Antibody (FITC) |
|
20-abx107395 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) BTF3 antibody (HRP) |
|
60R-1900 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody (HRP) |
) BTF3 antibody (FITC) |
|
60R-1901 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody (FITC) |
) BTF3 antibody (biotin) |
|
60R-1902 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody (biotin) |
 Anti-BTF3 antibody |
|
STJ117454 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. |
Anti-BTF3 antibody |
|
STJ191532 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to BTF3 |
 Protein) Transcription Factor BTF3 (BTF3) Protein |
|
20-abx263330 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
) Human Transcription factor BTF3 (BTF3) |
|
1-CSB-RP017144h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 44.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Transcription factor BTF3(BTF3),partial expressed in E.coli |
 BTF3 siRNA |
|
20-abx909378 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTF3 siRNA |
|
20-abx909379 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 BTF3 Antibody, HRP conjugated |
|
1-CSB-PA01714B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 BTF3 Antibody, FITC conjugated |
|
1-CSB-PA01714C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 BTF3 Antibody, Biotin conjugated |
|
1-CSB-PA01714D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ELISA Kit) Human Transcription Factor BTF3 (BTF3) ELISA Kit |
|
20-abx585082 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 Human Transcription factor BTF3, BTF3 ELISA KIT |
|
ELI-25124h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Transcription factor BTF3, Btf3 ELISA KIT |
|
ELI-25125m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Transcription Factor BTF3 (BTF3) ELISA Kit |
|
abx384619-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Transcription Factor BTF3 (BTF3) ELISA Kit |
|
abx388654-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 BTF3 cloning plasmid |
|
CSB-CL002855HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 489
- Sequence: atgaaagaaacaatcatgaaccaggaaaaactcgccaaactgcaggcacaagtgcgcattggtgggaaaggaactgctcgcagaaagaagaaggtggttcatagaacagccacagcagatgacaaaaaacttcagttctccttaaagaagttaggggtaaacaatatctctggtat
- Show more
|
|
Description: A cloning plasmid for the BTF3 gene. |
 BTF3 Blocking Peptide |
|
33R-2169 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BTF3 antibody, catalog no. 20R-1189 |
 Btf3 ELISA Kit| Mouse Transcription factor BTF3 ELISA Kit |
|
EF014279 |
Lifescience Market |
96 Tests |
EUR 689 |
 Mouse BTF3 shRNA Plasmid |
|
20-abx981197 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human BTF3 shRNA Plasmid |
|
20-abx950481 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) BTF3 protein (His tag) |
|
30R-2934 |
Fitzgerald |
20 ug |
EUR 322 |
|
Description: Purified recombinant Human BTF3 protein (His tag) |
) BTF3 Recombinant Protein (Human) |
|
RP003259 |
ABM |
100 ug |
Ask for price |
BTF3 Recombinant Protein (Human) |
|
RP003262 |
ABM |
100 ug |
Ask for price |
) BTF3 Recombinant Protein (Rat) |
|
RP192533 |
ABM |
100 ug |
Ask for price |
) BTF3 Recombinant Protein (Mouse) |
|
RP120080 |
ABM |
100 ug |
Ask for price |
BTF3 Recombinant Protein (Mouse) |
|
RP120083 |
ABM |
100 ug |
Ask for price |
) Anti-BTF3 (3C4-2E11) |
|
YF-MA12198 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to BTF3 |
 ELISA kit) Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit |
|
E04T0602-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit |
|
E04T0602-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit |
|
E04T0602-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
20-abx148705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
20-abx134660 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
abx027527-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
abx027527-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
20-abx325242 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) BTF3 ORF Vector (Human) (pORF) |
|
ORF001087 |
ABM |
1.0 ug DNA |
EUR 95 |
BTF3 ORF Vector (Human) (pORF) |
|
ORF001088 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Btf3 ORF Vector (Mouse) (pORF) |
|
ORF040028 |
ABM |
1.0 ug DNA |
EUR 506 |
Btf3 ORF Vector (Mouse) (pORF) |
|
ORF040029 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Btf3 ORF Vector (Rat) (pORF) |
|
ORF064179 |
ABM |
1.0 ug DNA |
EUR 506 |
) BTF3 sgRNA CRISPR Lentivector set (Human) |
|
K0199901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Btf3 sgRNA CRISPR Lentivector set (Rat) |
|
K7460101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Btf3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4941901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) BTF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0199902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) BTF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0199903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) BTF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0199904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Btf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7460102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Btf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7460103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Btf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7460104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4941902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4941903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4941904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) BTF3 Protein Vector (Human) (pPB-C-His) |
|
PV004345 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) BTF3 Protein Vector (Human) (pPB-N-His) |
|
PV004346 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) BTF3 Protein Vector (Human) (pPM-C-HA) |
|
PV004347 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) BTF3 Protein Vector (Human) (pPM-C-His) |
|
PV004348 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-C-His) |
|
PV004349 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-N-His) |
|
PV004350 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPM-C-HA) |
|
PV004351 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPM-C-His) |
|
PV004352 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-MBP)) BTF3 Protein Vector (Human) (pPB-His-MBP) |
|
PV327754 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) BTF3 Protein Vector (Human) (pPB-His-GST) |
|
PV327755 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-His-MBP) |
|
PV327758 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-His-GST) |
|
PV327759 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) BTF3 Protein Vector (Rat) (pPB-C-His) |
|
PV256714 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) BTF3 Protein Vector (Rat) (pPB-N-His) |
|
PV256715 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) BTF3 Protein Vector (Rat) (pPM-C-HA) |
|
PV256716 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) BTF3 Protein Vector (Rat) (pPM-C-His) |
|
PV256717 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) BTF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV160110 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) BTF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV160111 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) BTF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV160112 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) BTF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV160113 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV160114 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV160115 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV160116 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV160117 |
ABM |
500 ng |
EUR 603 |
 Btf3 3'UTR Luciferase Stable Cell Line |
|
TU201456 |
ABM |
1.0 ml |
Ask for price |
 Btf3 3'UTR GFP Stable Cell Line |
|
TU152883 |
ABM |
1.0 ml |
Ask for price |
 BTF3 3'UTR Luciferase Stable Cell Line |
|
TU001945 |
ABM |
1.0 ml |
EUR 1394 |
Btf3 3'UTR Luciferase Stable Cell Line |
|
TU102883 |
ABM |
1.0 ml |
Ask for price |
 BTF3 3'UTR GFP Stable Cell Line |
|
TU051945 |
ABM |
1.0 ml |
EUR 1394 |
Btf3 3'UTR GFP Stable Cell Line |
|
TU251456 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
BTF3 Rabbit Polyclonal Antibody
