 BTF3 Polyclonal Antibody |
|
ABP57929-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200 |
BTF3 Polyclonal Antibody |
|
ABP57929-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200 |
BTF3 Polyclonal Antibody |
|
ABP57929-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BTF3 from Human, Mouse. This BTF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTF3 protein at amino acid sequence of 120-200 |
BTF3 Polyclonal Antibody |
|
ES10374-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against BTF3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BTF3 Polyclonal Antibody |
|
ES10374-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against BTF3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 BTF3 Rabbit pAb |
|
A15259-100ul |
Abclonal |
100 ul |
EUR 308 |
BTF3 Rabbit pAb |
|
A15259-200ul |
Abclonal |
200 ul |
EUR 459 |
BTF3 Rabbit pAb |
|
A15259-20ul |
Abclonal |
20 ul |
EUR 183 |
BTF3 Rabbit pAb |
|
A15259-50ul |
Abclonal |
50 ul |
EUR 223 |
 BTF3 Polyclonal Conjugated Antibody |
|
C28890 |
SAB |
100ul |
EUR 397 |
 Antibody) Transcription Factor BTF3 (BTF3) Antibody |
|
abx026082-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 (BTF3) Antibody |
|
abx026082-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 (BTF3) Antibody |
|
20-abx110270 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 BTF3 antibody |
|
20R-1189 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal BTF3 antibody |
BTF3 antibody |
|
70R-15362 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody |
BTF3 antibody |
|
10R-1391 |
Fitzgerald |
100 ug |
EUR 512 |
|
Description: Mouse monoclonal BTF3 antibody |
 BTF3 Antibody |
|
1-CSB-PA01714A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 BTF3 Polyclonal Antibody, HRP Conjugated |
|
A51858 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 BTF3 Polyclonal Antibody, FITC Conjugated |
|
A51859 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 BTF3 Polyclonal Antibody, Biotin Conjugated |
|
A51860 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Antibody (Biotin)) Transcription Factor BTF3 (BTF3) Antibody (Biotin) |
|
20-abx105980 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Transcription Factor BTF3 (BTF3) Antibody (FITC) |
|
20-abx107395 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Transcription Factor BTF3 (BTF3) Antibody (HRP) |
|
20-abx108815 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody Pair) Transcription Factor BTF3 (BTF3) Antibody Pair |
|
abx117418-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
) BTF3 antibody (HRP) |
|
60R-1900 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody (HRP) |
) BTF3 antibody (FITC) |
|
60R-1901 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody (FITC) |
) BTF3 antibody (biotin) |
|
60R-1902 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal BTF3 antibody (biotin) |
 Anti-BTF3 antibody |
|
STJ117454 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. |
Anti-BTF3 antibody |
|
STJ191532 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to BTF3 |
) Human Transcription factor BTF3 (BTF3) |
|
1-CSB-RP017144h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 44.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Transcription factor BTF3(BTF3),partial expressed in E.coli |
 Protein) Transcription Factor BTF3 (BTF3) Protein |
|
20-abx263330 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 BTF3 siRNA |
|
20-abx909378 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTF3 siRNA |
|
20-abx909379 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 BTF3 Antibody, HRP conjugated |
|
1-CSB-PA01714B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 BTF3 Antibody, FITC conjugated |
|
1-CSB-PA01714C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 BTF3 Antibody, Biotin conjugated |
|
1-CSB-PA01714D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against BTF3. Recognizes BTF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Human Transcription factor BTF3, BTF3 ELISA KIT |
|
ELI-25124h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Transcription factor BTF3, Btf3 ELISA KIT |
|
ELI-25125m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Human Transcription Factor BTF3 (BTF3) ELISA Kit |
|
abx384619-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Transcription Factor BTF3 (BTF3) ELISA Kit |
|
20-abx585082 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Transcription Factor BTF3 (BTF3) ELISA Kit |
|
abx388654-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 BTF3 Blocking Peptide |
|
33R-2169 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BTF3 antibody, catalog no. 20R-1189 |
 BTF3 cloning plasmid |
|
CSB-CL002855HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 489
- Sequence: atgaaagaaacaatcatgaaccaggaaaaactcgccaaactgcaggcacaagtgcgcattggtgggaaaggaactgctcgcagaaagaagaaggtggttcatagaacagccacagcagatgacaaaaaacttcagttctccttaaagaagttaggggtaaacaatatctctggtat
- Show more
|
|
Description: A cloning plasmid for the BTF3 gene. |
 Btf3 ELISA Kit| Mouse Transcription factor BTF3 ELISA Kit |
|
EF014279 |
Lifescience Market |
96 Tests |
EUR 689 |
) BTF3 protein (His tag) |
|
30R-2934 |
Fitzgerald |
20 ug |
EUR 322 |
|
Description: Purified recombinant Human BTF3 protein (His tag) |
 Mouse BTF3 shRNA Plasmid |
|
20-abx981197 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human BTF3 shRNA Plasmid |
|
20-abx950481 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) BTF3 Recombinant Protein (Human) |
|
RP003259 |
ABM |
100 ug |
Ask for price |
BTF3 Recombinant Protein (Human) |
|
RP003262 |
ABM |
100 ug |
Ask for price |
) BTF3 Recombinant Protein (Rat) |
|
RP192533 |
ABM |
100 ug |
Ask for price |
) BTF3 Recombinant Protein (Mouse) |
|
RP120080 |
ABM |
100 ug |
Ask for price |
BTF3 Recombinant Protein (Mouse) |
|
RP120083 |
ABM |
100 ug |
Ask for price |
) Anti-BTF3 (3C4-2E11) |
|
YF-MA12198 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to BTF3 |
 ELISA kit) Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit |
|
E04T0602-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit |
|
E04T0602-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transcription factor BTF3 homolog 4(BTF3L4) ELISA kit |
|
E04T0602-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transcription factor BTF3 homolog 4(BTF3L4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
abx027527-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
abx027527-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
20-abx134660 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
20-abx148705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transcription Factor BTF3 Homolog 4 (BTF3L4) Antibody |
|
20-abx325242 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) Btf3 ORF Vector (Rat) (pORF) |
|
ORF064179 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) BTF3 ORF Vector (Human) (pORF) |
|
ORF001087 |
ABM |
1.0 ug DNA |
EUR 95 |
BTF3 ORF Vector (Human) (pORF) |
|
ORF001088 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Btf3 ORF Vector (Mouse) (pORF) |
|
ORF040028 |
ABM |
1.0 ug DNA |
EUR 506 |
Btf3 ORF Vector (Mouse) (pORF) |
|
ORF040029 |
ABM |
1.0 ug DNA |
EUR 506 |
) Btf3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4941901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Btf3 sgRNA CRISPR Lentivector set (Rat) |
|
K7460101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) BTF3 sgRNA CRISPR Lentivector set (Human) |
|
K0199901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4941902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4941903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Btf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4941904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Btf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7460102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Btf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7460103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Btf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7460104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) BTF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0199902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) BTF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0199903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) BTF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0199904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) BTF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV160110 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) BTF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV160111 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) BTF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV160112 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) BTF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV160113 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV160114 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV160115 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV160116 |
ABM |
500 ng |
EUR 603 |
BTF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV160117 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) BTF3 Protein Vector (Rat) (pPB-C-His) |
|
PV256714 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) BTF3 Protein Vector (Rat) (pPB-N-His) |
|
PV256715 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) BTF3 Protein Vector (Rat) (pPM-C-HA) |
|
PV256716 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) BTF3 Protein Vector (Rat) (pPM-C-His) |
|
PV256717 |
ABM |
500 ng |
EUR 603 |
 (pPB-His-MBP)) BTF3 Protein Vector (Human) (pPB-His-MBP) |
|
PV327754 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) BTF3 Protein Vector (Human) (pPB-His-GST) |
|
PV327755 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-His-MBP) |
|
PV327758 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-His-GST) |
|
PV327759 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) BTF3 Protein Vector (Human) (pPB-C-His) |
|
PV004345 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) BTF3 Protein Vector (Human) (pPB-N-His) |
|
PV004346 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) BTF3 Protein Vector (Human) (pPM-C-HA) |
|
PV004347 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) BTF3 Protein Vector (Human) (pPM-C-His) |
|
PV004348 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-C-His) |
|
PV004349 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPB-N-His) |
|
PV004350 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPM-C-HA) |
|
PV004351 |
ABM |
500 ng |
EUR 329 |
BTF3 Protein Vector (Human) (pPM-C-His) |
|
PV004352 |
ABM |
500 ng |
EUR 329 |
 Btf3 3'UTR GFP Stable Cell Line |
|
TU152883 |
ABM |
1.0 ml |
Ask for price |
 Btf3 3'UTR Luciferase Stable Cell Line |
|
TU102883 |
ABM |
1.0 ml |
Ask for price |
Btf3 3'UTR Luciferase Stable Cell Line |
|
TU201456 |
ABM |
1.0 ml |
Ask for price |
Btf3 3'UTR GFP Stable Cell Line |
|
TU251456 |
ABM |
1.0 ml |
Ask for price |
 BTF3 3'UTR GFP Stable Cell Line |
|
TU051945 |
ABM |
1.0 ml |
EUR 1394 |
 BTF3 3'UTR Luciferase Stable Cell Line |
|
TU001945 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
BTF3 Rabbit Polyclonal Antibody
