CCL16 Rabbit Polyclonal Antibody

CCL16 Polyclonal Antibody
ES10265-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL16 Polyclonal Antibody
ES10265-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL16 Rabbit pAb
A15317-100ul 100 ul
EUR 308

CCL16 Rabbit pAb
A15317-200ul 200 ul
EUR 459

CCL16 Rabbit pAb
A15317-20ul 20 ul
EUR 183

CCL16 Rabbit pAb
A15317-50ul 50 ul
EUR 223

CCL16 antibody
70R-10494 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL16 antibody

CCL16 Antibody
46941-100ul 100ul
EUR 252

CCL16 Antibody
37464-100ul 100ul
EUR 252

CCL16 Antibody
1-CSB-PA08967A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CCL16 Antibody
1-CSB-PA940582
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

CCL16 Antibody
DF9912 200ul
EUR 304
Description: CCL16 Antibody detects endogenous levels of total CCL16.

CCL16 Antibody
1-CSB-PA169235
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CCL16 antibody
70R-7847 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL16 antibody

CCL16 Antibody
ABD9912 100 ug
EUR 438

Rabbit CCL16 ELISA Kit
ERTC0607 96Tests
EUR 521

CCL16 Polyclonal Antibody, HRP Conjugated
A55424 100 µg
EUR 570.55
Description: Ask the seller for details

CCL16 Polyclonal Antibody, FITC Conjugated
A55425 100 µg
EUR 570.55
Description: The best epigenetics products

CCL16 Polyclonal Antibody, Biotin Conjugated
A55426 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-CCL16 Antibody
A07545-1 100ug/vial
EUR 294

CCL16 Conjugated Antibody
C37464 100ul
EUR 397

CCL16 Conjugated Antibody
C46941 100ul
EUR 397

Anti-CCL16 antibody
STJ117512 100 µl
EUR 277
Description: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for lymphocytes and monocytes but not for neutrophils. This cytokine also shows a potent myelosuppressive activity and suppresses proliferation of myeloid progenitor cells. The expression of this gene is upregulated by IL-10.

Anti-CCL16 antibody
STJ191423 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL16

CCL16 protein
30R-2577 20 ug
EUR 302
Description: Purified recombinant Human CCL16 protein

CCL16 siRNA
20-abx910758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL16 Antibody, HRP conjugated
1-CSB-PA08967B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL16 Antibody, FITC conjugated
1-CSB-PA08967C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL16 Antibody, Biotin conjugated
1-CSB-PA08967D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCL16 Blocking Peptide
33R-5134 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-10494

CCL16 Blocking Peptide
33R-8609 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-7847

CCL16, human recombinant
4349-1000
EUR 4617

CCL16, human recombinant
4349-20
EUR 256

CCL16 Blocking Peptide
DF9912-BP 1mg
EUR 195

CCL16 cloning plasmid
CSB-CL004779HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 363
  • Sequence: ATGAAGGTCTCCGAGGCTGCCCTGTCTCTCCTTGTCCTCATCCTTATCATTACTTCGGCTTCTCGCAGCCAGCCAAAAGTTCCTGAGTGGGTGAACACCCCATCCACCTGCTGCCTGAAGTATTATGAGAAAGTGTTGCCAAGGAGACTAGTGGTGGGATACAGAAAGGCCCTCAA
  • Show more
Description: A cloning plasmid for the CCL16 gene.

Anti-LEC/CCL16/HCC4 antibody
STJ16100997 100 µg
EUR 354

Human CCL16 ELISA Kit
ELA-E0138h 96 Tests
EUR 824

Human CCL16 ELISA Kit
EHC0607 96Tests
EUR 521

CCL16 Rabbit Polyclonal Antibody