Biocat Net

NBPF3 Polyclonal Antibody
ABP59406-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490 Applications tips:
Description: A polyclonal antibody for detection of NBPF3 from Human. This NBPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490

NBPF3 Polyclonal Antibody
ABP59406-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490 Applications tips:
Description: A polyclonal antibody for detection of NBPF3 from Human. This NBPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490

NBPF3 Polyclonal Antibody
ABP59406-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490 Applications tips:
Description: A polyclonal antibody for detection of NBPF3 from Human. This NBPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NBPF3 protein at amino acid sequence of 410-490

NBPF3 Polyclonal Antibody
A67478	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NBPF3 Antibody
abx146004-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

NBPF3 Antibody
ABD9684	Lifescience Market	100 ug	EUR 438

NBPF3 Antibody
46081-100ul	SAB	100ul	EUR 252

NBPF3 Antibody
46081-50ul	SAB	50ul	EUR 187

NBPF3 Antibody
DF9684	Affbiotech	200ul	EUR 304
Description: NBPF3 Antibody detects endogenous levels of total NBPF3.

NBPF3 Antibody
1-CSB-PA872422LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NBPF3 Polyclonal Antibody, HRP Conjugated
A67479	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NBPF3 Polyclonal Antibody, FITC Conjugated
A67480	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NBPF3 Polyclonal Antibody, Biotin Conjugated
A67481	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NBPF3 Conjugated Antibody
C46081	SAB	100ul	EUR 397

NBPF3 Antibody (HRP)
20-abx311149	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NBPF3 Antibody (FITC)
20-abx311150	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NBPF3 Antibody (Biotin)
20-abx311151	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-NBPF3 antibody
STJ191059	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NBPF3

NBPF3 siRNA
20-abx925461	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pBlueScriptR-NBPF3
PVT17368	Lifescience Market	2 ug	EUR 231

NBPF3 Antibody, HRP conjugated
1-CSB-PA872422LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NBPF3 Antibody, FITC conjugated
1-CSB-PA872422LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NBPF3 Antibody, Biotin conjugated
1-CSB-PA872422LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against NBPF3. Recognizes NBPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NBPF3 cloning plasmid
CSB-CL872422HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1017 Sequence: atgccactgactcccactgtccagggcttccagtggactctccgaggccctgatgtagaaacttccccattcggtgcaccaagagcagcctcacatggtgtgggccgacatcaagagctgcgagatccaacagtccctggccccacctcttctgccacaaacgtcagcatggtgg Show more
Description: A cloning plasmid for the NBPF3 gene.

NBPF3 Blocking Peptide
DF9684-BP	Affbiotech	1mg	EUR 195

Human NBPF3 shRNA Plasmid
20-abx963360	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NBPF3 Recombinant Protein (Human)
RP020770	ABM	100 ug	Ask for price

NBPF3 ORF Vector (Human) (pORF)
ORF006924	ABM	1.0 ug DNA	EUR 95

Neuroblastoma Breakpoint Family Member 3 (NBPF3) Antibody
20-abx311148	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuroblastoma Breakpoint Family Member 3 (NBPF3) Antibody
20-abx217125	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

NBPF3 Rabbit Polyclonal Antibody