NFIX Polyclonal Antibody |
A64710 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NFIX Polyclonal Antibody |
31707-100ul |
SAB |
100ul |
EUR 252 |
NFIX Polyclonal Antibody |
31707-50ul |
SAB |
50ul |
EUR 187 |
NFIX Rabbit pAb |
A9390-100ul |
Abclonal |
100 ul |
EUR 308 |
NFIX Rabbit pAb |
A9390-200ul |
Abclonal |
200 ul |
EUR 459 |
NFIX Rabbit pAb |
A9390-20ul |
Abclonal |
20 ul |
EUR 183 |
NFIX Rabbit pAb |
A9390-50ul |
Abclonal |
50 ul |
EUR 223 |
NFIX Polyclonal Conjugated Antibody |
C31707 |
SAB |
100ul |
EUR 397 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
NFIX Antibody |
1-CSB-PA617941LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NFIX Polyclonal Antibody, HRP Conjugated |
A64711 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
NFIX Polyclonal Antibody, FITC Conjugated |
A64712 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NFIX Polyclonal Antibody, Biotin Conjugated |
A64713 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NFIX-Specific Antibody |
abx235701-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-NFIX antibody |
STJ113639 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. |
Anti-NFIX antibody |
STJ191090 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NFIX |
NFIX siRNA |
20-abx925823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NFIX siRNA |
20-abx925824 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NFIX |
YF-PA13434 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NFIX |
anti- NFIX-Specific antibody |
FNab05701 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- Immunogen: nuclear factor I/X(CCAAT-binding transcription factor)
- Uniprot ID: Q14938
- Research Area: Neuroscience, Epigenetics
|
Description: Antibody raised against NFIX-Specific |
NFIX Antibody, HRP conjugated |
1-CSB-PA617941LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NFIX Antibody, FITC conjugated |
1-CSB-PA617941LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NFIX Antibody, Biotin conjugated |
1-CSB-PA617941LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat) |
4-PAF665Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX) |
NFIX cloning plasmid |
CSB-CL617941HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1323
- Sequence: atgctcccggcttgccgcctgcaggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagc
- Show more
|
Description: A cloning plasmid for the NFIX gene. |
Anti-NFIX (3D2) |
YF-MA14438 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NFIX |
NFIA / NFIB / NFIC / NFIX Antibody |
20-abx328698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NFIA/NFIB/NFIC/NFIX Antibody |
1-CSB-PA020079 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NFIA/NFIB/NFIC/NFIX. Recognizes NFIA/NFIB/NFIC/NFIX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), APC |
4-PAF665Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with APC. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Biotinylated |
4-PAF665Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Biotin. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Cy3 |
4-PAF665Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Cy3. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), FITC |
4-PAF665Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with FITC. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), HRP |
4-PAF665Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with HRP. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), PE |
4-PAF665Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with PE. |
Nuclear Factor I/X (NFIX) Antibody |
20-abx124360 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Factor I/X (NFIX) Antibody |
20-abx131368 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nuclear Factor I/X (NFIX) Antibody |
abx122648-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nuclear Factor I/X (NFIX) Antibody |
20-abx173857 |
Abbexa |
|
|
|
Nuclear Factor I/X (NFIX) Antibody |
20-abx306877 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human NFIX shRNA Plasmid |
20-abx953176 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NFIX shRNA Plasmid |
20-abx971729 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NFIX Recombinant Protein (Human) |
RP041638 |
ABM |
100 ug |
Ask for price |
NFIX Rabbit Polyclonal Antibody