Biocat Net

Amine biocat 3.0

NFIX Rabbit Polyclonal Antibody

NFIX Polyclonal Antibody

A64710 100 µg
EUR 570.55
Description: Ask the seller for details

NFIX Polyclonal Antibody

31707-100ul 100ul
EUR 252

NFIX Polyclonal Antibody

31707-50ul 50ul
EUR 187

NFIX Rabbit pAb

A9390-100ul 100 ul
EUR 308

NFIX Rabbit pAb

A9390-200ul 200 ul
EUR 459

NFIX Rabbit pAb

A9390-20ul 20 ul
EUR 183

NFIX Rabbit pAb

A9390-50ul 50 ul
EUR 223

NFIX Polyclonal Conjugated Antibody

C31707 100ul
EUR 397

Human Nuclear Factor I/X (NFIX) ELISA Kit

EUR 517
  • Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Human Nuclear Factor I/X (NFIX) ELISA Kit

EUR 673
  • Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

EUR 527
  • Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

EUR 688
  • Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Factor I/X (NFIX) ELISA Kit

EUR 549
  • Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Factor I/X (NFIX) ELISA Kit

EUR 718
  • Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Human Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Hu-48Tests 48 Tests
EUR 521

Human Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Hu-96Tests 96 Tests
EUR 723

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Mu-48Tests 48 Tests
EUR 533

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Mu-96Tests 96 Tests
EUR 740

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Ra-48Tests 48 Tests
EUR 557

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Ra-96Tests 96 Tests
EUR 775

Human Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Hu-48Tests 48 Tests
EUR 544

Human Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Hu-96Tests 96 Tests
EUR 756

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Mu-48Tests 48 Tests
EUR 557

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Mu-96Tests 96 Tests
EUR 774

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Ra-48Tests 48 Tests
EUR 583

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Ra-96Tests 96 Tests
EUR 811

NFIX Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NFIX Polyclonal Antibody, HRP Conjugated

A64711 100 µg
EUR 570.55
Description: The best epigenetics products

NFIX Polyclonal Antibody, FITC Conjugated

A64712 100 µg
EUR 570.55
Description: kits suitable for this type of research

NFIX Polyclonal Antibody, Biotin Conjugated

A64713 100 µg
EUR 570.55
Description: fast delivery possible

NFIX-Specific Antibody

abx235701-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-NFIX antibody

STJ113639 100 µl
EUR 277
Description: The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene.

Anti-NFIX antibody

STJ191090 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NFIX


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13434 50 ug
EUR 363
Description: Mouse polyclonal to NFIX

anti- NFIX-Specific antibody

FNab05701 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: nuclear factor I/X(CCAAT-binding transcription factor)
  • Uniprot ID: Q14938
  • Research Area: Neuroscience, Epigenetics
Description: Antibody raised against NFIX-Specific

NFIX Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NFIX Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NFIX Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-NFIX-Specific antibody

PAab05701 100 ug
EUR 386

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX)

NFIX cloning plasmid

CSB-CL617941HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgctcccggcttgccgcctgcaggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagc
  • Show more
Description: A cloning plasmid for the NFIX gene.

Anti-NFIX (3D2)

YF-MA14438 100 ug
EUR 363
Description: Mouse monoclonal to NFIX

NFIA / NFIB / NFIC / NFIX Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFIA/NFIB/NFIC/NFIX. Recognizes NFIA/NFIB/NFIC/NFIX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with APC.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Biotin.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Cy3.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with FITC.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with HRP.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with PE.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nuclear Factor I/X (NFIX) Antibody

abx122648-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF001208 96 Tests
EUR 689

Human NFIX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NFIX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFIX Recombinant Protein (Human)

RP041638 100 ug Ask for price

NFIX Rabbit Polyclonal Antibody