NLGN1 Polyclonal Antibody |
ABP59477-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NLGN1 protein at amino acid sequence of 410-490
- Applications tips:
|
Description: A polyclonal antibody for detection of NLGN1 from Human, Mouse, Rat. This NLGN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN1 protein at amino acid sequence of 410-490 |
Rat Neuroligin 1 (NLGN1) ELISA Kit |
DLR-NLGN1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Neuroligin 1 (NLGN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuroligin 1 (NLGN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Neuroligin 1 (NLGN1) ELISA Kit |
DLR-NLGN1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Neuroligin 1 (NLGN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuroligin 1 (NLGN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Neuroligin 1 (NLGN1) ELISA Kit |
RD-NLGN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Neuroligin 1 (NLGN1) ELISA Kit |
RD-NLGN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Neuroligin 1 (NLGN1) ELISA Kit |
RDR-NLGN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Neuroligin 1 (NLGN1) ELISA Kit |
RDR-NLGN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
NLGN1 Rabbit pAb |
A16105-100ul |
Abclonal |
100 ul |
EUR 308 |
NLGN1 Rabbit pAb |
A16105-200ul |
Abclonal |
200 ul |
EUR 459 |
NLGN1 Rabbit pAb |
A16105-20ul |
Abclonal |
20 ul |
EUR 183 |
NLGN1 Rabbit pAb |
A16105-50ul |
Abclonal |
50 ul |
EUR 223 |
NLGN1 Antibody |
36650-100ul |
SAB |
100ul |
EUR 252 |
NLGN1 Antibody |
46627-100ul |
SAB |
100ul |
EUR 252 |
NLGN1 Antibody |
DF9690 |
Affbiotech |
200ul |
EUR 304 |
Description: NLGN1 Antibody detects endogenous levels of total NLGN1. |
NLGN1 Antibody |
1-CSB-PA928711 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
NLGN1 Antibody |
1-CSB-PA839786LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
NLGN1 Conjugated Antibody |
C36650 |
SAB |
100ul |
EUR 397 |
Anti-NLGN1 antibody |
STJ191069 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NLGN1 |
NLGN1 siRNA |
20-abx903571 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLGN1 siRNA |
20-abx925994 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLGN1 siRNA |
20-abx925995 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuroligin 1 (Nlgn1) Antibody |
20-abx121178 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neuroligin 1 (NLGN1) Antibody |
abx122672-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Neuroligin 1 (Nlgn1) Antibody |
abx433026-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Neuroligin 1 (Nlgn1) Antibody |
abx445072-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Neuroligin 1 (NLGN1) Antibody |
20-abx302401 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuroligin 1 (NLGN1) Antibody |
20-abx210876 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLGN1 Antibody, HRP conjugated |
1-CSB-PA839786LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NLGN1 Antibody, FITC conjugated |
1-CSB-PA839786LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NLGN1 Antibody, Biotin conjugated |
1-CSB-PA839786LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NLGN1 Blocking Peptide |
DF9690-BP |
Affbiotech |
1mg |
EUR 195 |
NLGN1 cloning plasmid |
CSB-CL839786HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2472
- Sequence: atggcactgcccagatgcacgtggccaaattatgtttggagagcagtgatggcatgcttggtacaccggggattgggtgccccattgactctctgtatgttgggatgtttgcttcaggctggccatgtgctatcacaaaaattggatgatgtggacccactggtggctaccaact
- Show more
|
Description: A cloning plasmid for the NLGN1 gene. |
anti-NLGN1 + NLGN2 |
YF-PA17644 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NLGN1 + NLGN2 |
anti-NLGN1 + NLGN2 |
YF-PA25805 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NLGN1 + NLGN2 |
Neuroligin 1 (NLGN1) Antibody (HRP) |
20-abx317552 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuroligin 1 (NLGN1) Antibody (FITC) |
20-abx317553 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuroligin 1 (NLGN1) Antibody (Biotin) |
20-abx317554 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NLGN1 Rabbit Polyclonal Antibody