Biocat Net

Amine biocat 3.0

NLGN1 Rabbit Polyclonal Antibody

NLGN1 Polyclonal Antibody

ABP59477-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NLGN1 protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of NLGN1 from Human, Mouse, Rat. This NLGN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN1 protein at amino acid sequence of 410-490

Rat Neuroligin 1 (NLGN1) ELISA Kit

DLR-NLGN1-Ra-48T 48T
EUR 549
  • Should the Rat Neuroligin 1 (NLGN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuroligin 1 (NLGN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Neuroligin 1 (NLGN1) ELISA Kit

DLR-NLGN1-Ra-96T 96T
EUR 718
  • Should the Rat Neuroligin 1 (NLGN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuroligin 1 (NLGN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Neuroligin 1 (NLGN1) ELISA Kit

RD-NLGN1-Ra-48Tests 48 Tests
EUR 557

Rat Neuroligin 1 (NLGN1) ELISA Kit

RD-NLGN1-Ra-96Tests 96 Tests
EUR 775

Rat Neuroligin 1 (NLGN1) ELISA Kit

RDR-NLGN1-Ra-48Tests 48 Tests
EUR 583

Rat Neuroligin 1 (NLGN1) ELISA Kit

RDR-NLGN1-Ra-96Tests 96 Tests
EUR 811

NLGN1 Rabbit pAb

A16105-100ul 100 ul
EUR 308

NLGN1 Rabbit pAb

A16105-200ul 200 ul
EUR 459

NLGN1 Rabbit pAb

A16105-20ul 20 ul
EUR 183

NLGN1 Rabbit pAb

A16105-50ul 50 ul
EUR 223

NLGN1 Antibody

ABD9690 100 ug
EUR 438

NLGN1 Antibody

36650-100ul 100ul
EUR 252

NLGN1 Antibody

46627-100ul 100ul
EUR 252

NLGN1 Antibody

DF9690 200ul
EUR 304
Description: NLGN1 Antibody detects endogenous levels of total NLGN1.

NLGN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NLGN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NLGN1 Conjugated Antibody

C36650 100ul
EUR 397

Anti-NLGN1 antibody

STJ118558 100 µl
EUR 277

Anti-NLGN1 antibody

STJ191069 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NLGN1

Nlgn1/ Rat Nlgn1 ELISA Kit

ELI-20702r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Neuroligin 1 (Nlgn1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody

abx122672-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuroligin 1 (Nlgn1) Antibody

abx433026-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Neuroligin 1 (Nlgn1) Antibody

abx445072-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Neuroligin 1 (NLGN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NLGN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLGN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLGN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN1. Recognizes NLGN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NLGN1 Blocking Peptide

DF9690-BP 1mg
EUR 195

NLGN1 cloning plasmid

CSB-CL839786HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2472
  • Sequence: atggcactgcccagatgcacgtggccaaattatgtttggagagcagtgatggcatgcttggtacaccggggattgggtgccccattgactctctgtatgttgggatgtttgcttcaggctggccatgtgctatcacaaaaattggatgatgtggacccactggtggctaccaact
  • Show more
Description: A cloning plasmid for the NLGN1 gene.

anti-NLGN1 + NLGN2

YF-PA17644 50 ug
EUR 363
Description: Mouse polyclonal to NLGN1 + NLGN2

anti-NLGN1 + NLGN2

YF-PA25805 50 ul
EUR 334
Description: Mouse polyclonal to NLGN1 + NLGN2

Neuroligin 1 (NLGN1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 1 (NLGN1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NLGN1 Rabbit Polyclonal Antibody