NQO2 Rabbit Polyclonal Antibody

NQO2 Polyclonal Antibody

ABP59518-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120

NQO2 Polyclonal Antibody

ABP59518-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120

NQO2 Polyclonal Antibody

ABP59518-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120

Nqo2 Polyclonal Antibody

A50973 100 µg
EUR 570.55
Description: fast delivery possible

NQO2 Rabbit pAb

A11742-100ul 100 ul
EUR 308

NQO2 Rabbit pAb

A11742-200ul 200 ul
EUR 459

NQO2 Rabbit pAb

A11742-20ul 20 ul
EUR 183

NQO2 Rabbit pAb

A11742-50ul 50 ul
EUR 223

NQO2 Rabbit pAb

A11746-100ul 100 ul
EUR 308

NQO2 Rabbit pAb

A11746-200ul 200 ul
EUR 459

NQO2 Rabbit pAb

A11746-20ul 20 ul
EUR 183

NQO2 Rabbit pAb

A11746-50ul 50 ul
EUR 223

NQO2 Rabbit mAb

A3846-100ul 100 ul
EUR 410

NQO2 Rabbit mAb

A3846-200ul 200 ul
EUR 571

NQO2 Rabbit mAb

A3846-20ul 20 ul
EUR 221

NQO2 Rabbit mAb

A3846-50ul 50 ul
EUR 287

NQO2 Rabbit pAb

A5440-100ul 100 ul
EUR 308

NQO2 Rabbit pAb

A5440-200ul 200 ul
EUR 459

NQO2 Rabbit pAb

A5440-20ul 20 ul
EUR 183

NQO2 Rabbit pAb

A5440-50ul 50 ul
EUR 223

Polyclonal NQO2 Antibody (Center)

APR08809G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NQO2 (Center). This antibody is tested and proven to work in the following applications:

Anti-NQO2 Rabbit Monoclonal Antibody

M03112 100ug/vial
EUR 397
Description: Rabbit Monoclonal NQO2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

NQO2 Antibody

ABD7342 100 ug
EUR 438

NQO2 Antibody

49011-100ul 100ul
EUR 333

NQO2 Antibody

49011-50ul 50ul
EUR 239

NQO2 antibody

10R-1189 100 ul
EUR 316
Description: Mouse monoclonal NQO2 antibody

NQO2 Antibody

32849-100ul 100ul
EUR 252

NQO2 antibody

70R-18947 50 ul
EUR 435
Description: Rabbit polyclonal NQO2 antibody

NQO2 Antibody

DF7342 200ul
EUR 304
Description: NQO2 Antibody detects endogenous levels of total NQO2.

NQO2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

Nqo2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

NQO2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NQO2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

Polyclonal NQO2 Antibody (N-term)

APR08811G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NQO2 (N-term). This antibody is tested and proven to work in the following applications:

Nqo2 Polyclonal Antibody, HRP Conjugated

A50974 100 µg
EUR 570.55
Description: reagents widely cited

Nqo2 Polyclonal Antibody, FITC Conjugated

A50975 100 µg
EUR 570.55
Description: Ask the seller for details

Nqo2 Polyclonal Antibody, Biotin Conjugated

A50976 100 µg
EUR 570.55
Description: The best epigenetics products

NQO2 Conjugated Antibody

C49011 100ul
EUR 397

NQO2 Conjugated Antibody

C32849 100ul
EUR 397

anti- NQO2 antibody

FNab05831 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IP: 1:500-1:1000
  • IHC: 1:200-1:800
  • IF: 1:10-1:100
  • Immunogen: NAD(P)H dehydrogenase, quinone 2
  • Uniprot ID: P16083
  • Gene ID: 4835
  • Research Area: Metabolism
Description: Antibody raised against NQO2

Human NQO2 Antibody

33149-05111 150 ug
EUR 261

Anti-NQO2 antibody

PAab05831 100 ug
EUR 355

Anti-NQO2 antibody

STJ27393 100 µl
EUR 277
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants.

Anti-NQO2 antibody

STJ113336 100 µl
EUR 277
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants.

Anti-NQO2 antibody

STJ113339 100 µl
EUR 277
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants.

Anti-NQO2 antibody

STJ191344 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NQO2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13459 50 ug
EUR 363
Description: Mouse polyclonal to NQO2


YF-PA13460 100 ug
EUR 403
Description: Rabbit polyclonal to NQO2


YF-PA24252 50 ul
EUR 334
Description: Mouse polyclonal to NQO2

Rabbit Anti-NQO2 monoclonal antibody, clone TD17-79

DCABH-7027 100 ul
EUR 777

NQO2 recombinant monoclonal antibody

A5341 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NQO2 for WB,ELISA

Nqo2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Nqo2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Nqo2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

NQO2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NQO2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NQO2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NQO2 cloning plasmid

CSB-CL016040HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 696
  • Sequence: atggcaggtaagaaagtactcattgtctatgcacaccaggaacccaagtctttcaacggatccttgaagaatgtggctgtagatgaactgagcaggcagggctgcaccgtcacagtgtctgatttgtatgccatgaactttgagccgagggccacagacaaagatatcactggtac
  • Show more
Description: A cloning plasmid for the NQO2 gene.

NQO2 Blocking Peptide

DF7342-BP 1mg
EUR 195

Human NQO2 Antibody (Biotin Conjugate)

33149-05121 150 ug
EUR 369

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

abx034030-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

abx034030-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

abx028209-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

abx028209-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

abx235831-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human NQO2 AssayLite Antibody (FITC Conjugate)

33149-05141 150 ug
EUR 428

Human NQO2 AssayLite Antibody (RPE Conjugate)

33149-05151 150 ug
EUR 428

Human NQO2 AssayLite Antibody (APC Conjugate)

33149-05161 150 ug
EUR 428

Human NQO2 AssayLite Antibody (PerCP Conjugate)

33149-05171 150 ug
EUR 471

Rat NQO2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001311 96 Tests
EUR 689

Human NQO2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NQO2 protein (His tag)

80R-1288 100 ug
EUR 268
Description: Purified recombinant Human NQO2 protein

Mouse NQO2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat Ribosyldihydronicotinamide dehydrogenase (Nqo2)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Ribosyldihydronicotinamide dehydrogenase(Nqo2) expressed in Yeast

NQO2 Recombinant Protein (Human)

RP021577 100 ug Ask for price

NQO2 Recombinant Protein (Rat)

RP214421 100 ug Ask for price

NQO2 Recombinant Protein (Mouse)

RP154823 100 ug Ask for price

NQO2 Recombinant Protein (Mouse)

RP154826 100 ug Ask for price

NQO2 Recombinant Protein (Mouse)

RP154829 100 ug Ask for price

NQO2 Rabbit Polyclonal Antibody