OAZ3 Rabbit Polyclonal Antibody

OAZ3 Polyclonal Antibody

A63070 100 µg
EUR 570.55
Description: The best epigenetics products

OAZ3 Antibody

ABD9726 100 ug
EUR 438

OAZ3 antibody

70R-50999 100 ul
EUR 244
Description: Purified Polyclonal OAZ3 antibody

OAZ3 antibody

70R-9243 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal OAZ3 antibody

OAZ3 Antibody

46115-100ul 100ul
EUR 252

OAZ3 Antibody

46115-50ul 50ul
EUR 187

OAZ3 Antibody

DF9726 200ul
EUR 304
Description: OAZ3 Antibody detects endogenous levels of total OAZ3.

OAZ3 Antibody

1-CSB-PA016247LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

OAZ3 Polyclonal Antibody, HRP Conjugated

A63071 100 µg
EUR 570.55
Description: kits suitable for this type of research

OAZ3 Polyclonal Antibody, FITC Conjugated

A63072 100 µg
EUR 570.55
Description: fast delivery possible

OAZ3 Polyclonal Antibody, Biotin Conjugated

A63073 100 µg
EUR 570.55
Description: reagents widely cited

OAZ3 Conjugated Antibody

C46115 100ul
EUR 397

Anti-OAZ3 antibody

STJ191122 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OAZ3

OAZ3 siRNA

20-abx926740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OAZ3 siRNA

20-abx926741
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-OAZ3

YF-PA19164 50 ul
EUR 363
Description: Mouse polyclonal to OAZ3

OAZ3 Antibody, HRP conjugated

1-CSB-PA016247LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OAZ3 Antibody, FITC conjugated

1-CSB-PA016247LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OAZ3 Antibody, Biotin conjugated

1-CSB-PA016247LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

OAZ3 cloning plasmid

CSB-CL016247HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atgaccgtgccctggcggccaggaaagcgacgcatcacttataaggaagaggaggacttgacactccagccccgtcctgcctccagtgctcctgagtccctagtaggcctccaggagggcaaaagcaccgagcagggtaaccacgaccagcttaaagaactgtattcggctgggaa
  • Show more
Description: A cloning plasmid for the OAZ3 gene.

OAZ3 Blocking Peptide

20-abx063874
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

OAZ3 Blocking Peptide

33R-2147 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OAZ3 antibody, catalog no. 70R-9243

OAZ3 Blocking Peptide

DF9726-BP 1mg
EUR 195

Mouse OAZ3 shRNA Plasmid

20-abx974374
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OAZ3 shRNA Plasmid

20-abx959899
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OAZ3 Recombinant Protein (Human)

RP022018 100 ug Ask for price

OAZ3 Recombinant Protein (Rat)

RP214991 100 ug Ask for price

OAZ3 Recombinant Protein (Mouse)

RP155663 100 ug Ask for price

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody

20-abx008139
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody

20-abx217321
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody

20-abx304695
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (HRP)

20-abx304696
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (FITC)

20-abx304697
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (Biotin)

20-abx304698
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

OAZ3 ORF Vector (Human) (pORF)

ORF007340 1.0 ug DNA
EUR 95

Oaz3 ORF Vector (Rat) (pORF)

ORF071665 1.0 ug DNA
EUR 506

Oaz3 ORF Vector (Mouse) (pORF)

ORF051889 1.0 ug DNA
EUR 506

OAZ3 sgRNA CRISPR Lentivector set (Human)

K1473801 3 x 1.0 ug
EUR 339

Oaz3 sgRNA CRISPR Lentivector set (Mouse)

K3933501 3 x 1.0 ug
EUR 339

Oaz3 sgRNA CRISPR Lentivector set (Rat)

K7515301 3 x 1.0 ug
EUR 339

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1473802 1.0 ug DNA
EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1473803 1.0 ug DNA
EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1473804 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3933502 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3933503 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3933504 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7515302 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7515303 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7515304 1.0 ug DNA
EUR 154

OAZ3 Protein Vector (Human) (pPB-C-His)

PV029357 500 ng
EUR 329

OAZ3 Protein Vector (Human) (pPB-N-His)

PV029358 500 ng
EUR 329

OAZ3 Protein Vector (Human) (pPM-C-HA)

PV029359 500 ng
EUR 329

OAZ3 Protein Vector (Human) (pPM-C-His)

PV029360 500 ng
EUR 329

OAZ3 Protein Vector (Mouse) (pPB-C-His)

PV207554 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPB-N-His)

PV207555 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPM-C-HA)

PV207556 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPM-C-His)

PV207557 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPB-C-His)

PV286658 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPB-N-His)

PV286659 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPM-C-HA)

PV286660 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPM-C-His)

PV286661 500 ng
EUR 603

Oaz3 3'UTR GFP Stable Cell Line

TU164490 1.0 ml Ask for price

OAZ3 3'UTR Luciferase Stable Cell Line

TU016164 1.0 ml
EUR 1394

Oaz3 3'UTR Luciferase Stable Cell Line

TU114490 1.0 ml Ask for price

OAZ3 3'UTR GFP Stable Cell Line

TU066164 1.0 ml
EUR 1394

Oaz3 3'UTR GFP Stable Cell Line

TU264348 1.0 ml Ask for price

Oaz3 3'UTR Luciferase Stable Cell Line

TU214348 1.0 ml Ask for price

Mouse Ornithine decarboxylase antizyme 3, Oaz3 ELISA KIT

ELI-21393m 96 Tests
EUR 865

Human Ornithine decarboxylase antizyme 3, OAZ3 ELISA KIT

ELI-46337h 96 Tests
EUR 824

OAZ3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV641377 1.0 ug DNA
EUR 514

OAZ3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV641381 1.0 ug DNA
EUR 514

OAZ3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV641382 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

OAZ3 Rabbit Polyclonal Antibody