OAZ3 Rabbit Polyclonal Antibody

OAZ3 Polyclonal Antibody
A63070	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

OAZ3 Antibody
ABD9726	Lifescience Market	100 ug	EUR 438

OAZ3 antibody
70R-50999	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal OAZ3 antibody

OAZ3 antibody
70R-9243	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal OAZ3 antibody

OAZ3 Antibody
46115-100ul	SAB	100ul	EUR 252

OAZ3 Antibody
46115-50ul	SAB	50ul	EUR 187

OAZ3 Antibody
DF9726	Affbiotech	200ul	EUR 304
Description: OAZ3 Antibody detects endogenous levels of total OAZ3.

OAZ3 Antibody
1-CSB-PA016247LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

OAZ3 Polyclonal Antibody, HRP Conjugated
A63071	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

OAZ3 Polyclonal Antibody, FITC Conjugated
A63072	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

OAZ3 Polyclonal Antibody, Biotin Conjugated
A63073	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

OAZ3 Conjugated Antibody
C46115	SAB	100ul	EUR 397

Anti-OAZ3 antibody
STJ191122	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to OAZ3

OAZ3 siRNA
20-abx926740	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OAZ3 siRNA
20-abx926741	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-OAZ3
YF-PA19164	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to OAZ3

OAZ3 Antibody, HRP conjugated
1-CSB-PA016247LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OAZ3 Antibody, FITC conjugated
1-CSB-PA016247LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OAZ3 Antibody, Biotin conjugated
1-CSB-PA016247LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

OAZ3 cloning plasmid
CSB-CL016247HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 573 Sequence: atgaccgtgccctggcggccaggaaagcgacgcatcacttataaggaagaggaggacttgacactccagccccgtcctgcctccagtgctcctgagtccctagtaggcctccaggagggcaaaagcaccgagcagggtaaccacgaccagcttaaagaactgtattcggctgggaa Show more
Description: A cloning plasmid for the OAZ3 gene.

OAZ3 Blocking Peptide
20-abx063874	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

OAZ3 Blocking Peptide
33R-2147	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OAZ3 antibody, catalog no. 70R-9243

OAZ3 Blocking Peptide
DF9726-BP	Affbiotech	1mg	EUR 195

Mouse OAZ3 shRNA Plasmid
20-abx974374	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human OAZ3 shRNA Plasmid
20-abx959899	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

OAZ3 Recombinant Protein (Human)
RP022018	ABM	100 ug	Ask for price

OAZ3 Recombinant Protein (Rat)
RP214991	ABM	100 ug	Ask for price

OAZ3 Recombinant Protein (Mouse)
RP155663	ABM	100 ug	Ask for price

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody
20-abx008139	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody
20-abx217321	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody
20-abx304695	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (HRP)
20-abx304696	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (FITC)
20-abx304697	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (Biotin)
20-abx304698	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

OAZ3 ORF Vector (Human) (pORF)
ORF007340	ABM	1.0 ug DNA	EUR 95

Oaz3 ORF Vector (Rat) (pORF)
ORF071665	ABM	1.0 ug DNA	EUR 506

Oaz3 ORF Vector (Mouse) (pORF)
ORF051889	ABM	1.0 ug DNA	EUR 506

OAZ3 sgRNA CRISPR Lentivector set (Human)
K1473801	ABM	3 x 1.0 ug	EUR 339

Oaz3 sgRNA CRISPR Lentivector set (Mouse)
K3933501	ABM	3 x 1.0 ug	EUR 339

Oaz3 sgRNA CRISPR Lentivector set (Rat)
K7515301	ABM	3 x 1.0 ug	EUR 339

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1473802	ABM	1.0 ug DNA	EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1473803	ABM	1.0 ug DNA	EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1473804	ABM	1.0 ug DNA	EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3933502	ABM	1.0 ug DNA	EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3933503	ABM	1.0 ug DNA	EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3933504	ABM	1.0 ug DNA	EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7515302	ABM	1.0 ug DNA	EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7515303	ABM	1.0 ug DNA	EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7515304	ABM	1.0 ug DNA	EUR 154

OAZ3 Protein Vector (Human) (pPB-C-His)
PV029357	ABM	500 ng	EUR 329

OAZ3 Protein Vector (Human) (pPB-N-His)
PV029358	ABM	500 ng	EUR 329

OAZ3 Protein Vector (Human) (pPM-C-HA)
PV029359	ABM	500 ng	EUR 329

OAZ3 Protein Vector (Human) (pPM-C-His)
PV029360	ABM	500 ng	EUR 329

OAZ3 Protein Vector (Mouse) (pPB-C-His)
PV207554	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Mouse) (pPB-N-His)
PV207555	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Mouse) (pPM-C-HA)
PV207556	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Mouse) (pPM-C-His)
PV207557	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Rat) (pPB-C-His)
PV286658	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Rat) (pPB-N-His)
PV286659	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Rat) (pPM-C-HA)
PV286660	ABM	500 ng	EUR 603

OAZ3 Protein Vector (Rat) (pPM-C-His)
PV286661	ABM	500 ng	EUR 603

Oaz3 3'UTR GFP Stable Cell Line
TU164490	ABM	1.0 ml	Ask for price

OAZ3 3'UTR Luciferase Stable Cell Line
TU016164	ABM	1.0 ml	EUR 1394

Oaz3 3'UTR Luciferase Stable Cell Line
TU114490	ABM	1.0 ml	Ask for price

OAZ3 3'UTR GFP Stable Cell Line
TU066164	ABM	1.0 ml	EUR 1394

Oaz3 3'UTR GFP Stable Cell Line
TU264348	ABM	1.0 ml	Ask for price

Oaz3 3'UTR Luciferase Stable Cell Line
TU214348	ABM	1.0 ml	Ask for price

Mouse Ornithine decarboxylase antizyme 3, Oaz3 ELISA KIT
ELI-21393m	Lifescience Market	96 Tests	EUR 865

Human Ornithine decarboxylase antizyme 3, OAZ3 ELISA KIT
ELI-46337h	Lifescience Market	96 Tests	EUR 824

OAZ3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV641377	ABM	1.0 ug DNA	EUR 514

OAZ3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV641381	ABM	1.0 ug DNA	EUR 514

OAZ3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV641382	ABM	1.0 ug DNA	EUR 514

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

OAZ3 Rabbit Polyclonal Antibody