PEX13 Rabbit Polyclonal Antibody

PEX13 Polyclonal Antibody

ABP59880-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370

PEX13 Polyclonal Antibody

ABP59880-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370

PEX13 Polyclonal Antibody

ES9979-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PEX13 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEX13 Polyclonal Antibody

ES9979-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PEX13 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEX13 antibody

70R-12990 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PEX13 antibody

PEX13 Antibody

1-CSB-PA849799LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

Polyclonal PEX13 Antibody (C-Term)

AMM07099G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PEX13 (C-Term). This antibody is tested and proven to work in the following applications:

PEX13 Polyclonal Antibody, HRP Conjugated

A69112 100 ?g
EUR 628.55
Description: Ask the seller for details

PEX13 Polyclonal Antibody, FITC Conjugated

A69113 100 ?g
EUR 628.55
Description: The best epigenetics products

PEX13 Polyclonal Antibody, Biotin Conjugated

A69114 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Anti-PEX13 antibody

STJ70341 100 µg
EUR 359

Anti-PEX13 antibody

STJ191137 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PEX13

PEX13 siRNA

20-abx928276
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PEX13 siRNA

20-abx928277
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PEX13 Antibody, HRP conjugated

1-CSB-PA849799LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PEX13 Antibody, FITC conjugated

1-CSB-PA849799LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PEX13 Antibody, Biotin conjugated

1-CSB-PA849799LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Peroxisomal membrane protein PEX13, Pex13 ELISA KIT

ELI-16039m 96 Tests
EUR 865

Human Peroxisomal membrane protein PEX13, PEX13 ELISA KIT

ELI-43690h 96 Tests
EUR 824

Bovine Peroxisomal membrane protein PEX13, PEX13 ELISA KIT

ELI-37434b 96 Tests
EUR 928

PEX13 cloning plasmid

CSB-CL849799HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: atggcgtcccagccgccacctccccccaaaccctgggagacccgccgaattccgggagccggaccgggaccaggaccgggccccactttccaatctgctgatttgggtcctactttaatgacaagacctggacaaccagcacttaccagagtgcccccacctattcttccaaggc
  • Show more
Description: A cloning plasmid for the PEX13 gene.

Mouse PEX13 shRNA Plasmid

20-abx977682
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PEX13 shRNA Plasmid

20-abx953466
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PEX13 Recombinant Protein (Human)

RP023128 100 ug Ask for price

PEX13 Recombinant Protein (Mouse)

RP161381 100 ug Ask for price

PEX13 Recombinant Protein (Rat)

RP220082 100 ug Ask for price

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody

20-abx338710
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody

abx433119-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (HRP)

20-abx336976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (FITC)

20-abx336977
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (Biotin)

20-abx336978
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pex13 ORF Vector (Rat) (pORF)

ORF073362 1.0 ug DNA
EUR 506

PEX13 ORF Vector (Human) (pORF)

ORF007710 1.0 ug DNA
EUR 95

Pex13 ORF Vector (Mouse) (pORF)

ORF053795 1.0 ug DNA
EUR 506

Pex13 sgRNA CRISPR Lentivector set (Rat)

K6176001 3 x 1.0 ug
EUR 339

Pex13 sgRNA CRISPR Lentivector set (Mouse)

K4637501 3 x 1.0 ug
EUR 339

PEX13 sgRNA CRISPR Lentivector set (Human)

K1629601 3 x 1.0 ug
EUR 339

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6176002 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6176003 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6176004 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4637502 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4637503 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4637504 1.0 ug DNA
EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 1)

K1629602 1.0 ug DNA
EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 2)

K1629603 1.0 ug DNA
EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 3)

K1629604 1.0 ug DNA
EUR 154

PEX13 Protein Vector (Rat) (pPB-C-His)

PV293446 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPB-N-His)

PV293447 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPM-C-HA)

PV293448 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPM-C-His)

PV293449 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPB-C-His)

PV215178 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPB-N-His)

PV215179 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPM-C-HA)

PV215180 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPM-C-His)

PV215181 500 ng
EUR 603

PEX13 Protein Vector (Human) (pPB-C-His)

PV030837 500 ng
EUR 329

PEX13 Protein Vector (Human) (pPB-N-His)

PV030838 500 ng
EUR 329

PEX13 Protein Vector (Human) (pPM-C-HA)

PV030839 500 ng
EUR 329

PEX13 Protein Vector (Human) (pPM-C-His)

PV030840 500 ng
EUR 329

Pex13 3'UTR Luciferase Stable Cell Line

TU116209 1.0 ml Ask for price

Pex13 3'UTR GFP Stable Cell Line

TU166209 1.0 ml Ask for price

Pex13 3'UTR Luciferase Stable Cell Line

TU216094 1.0 ml Ask for price

Pex13 3'UTR GFP Stable Cell Line

TU266094 1.0 ml Ask for price

PEX13 3'UTR GFP Stable Cell Line

TU067754 1.0 ml
EUR 4617

PEX13 3'UTR Luciferase Stable Cell Line

TU017754 1.0 ml
EUR 4617

Recombinant Pichia pastoris PEX13 Protein (aa 252-380)

VAng-Cr6649-1mgEcoli 1 mg (E. coli)
EUR 3514
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein.

Recombinant Pichia pastoris PEX13 Protein (aa 252-380)

VAng-Cr6649-500gEcoli 500 µg (E. coli)
EUR 2429
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein.

Recombinant Schizosaccharomyces Pombe pex13 Protein (aa 1-288)

VAng-Yyj5741-inquire inquire Ask for price
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Peroxisomal membrane protein pex13 (pex13), recombinant protein.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PEX13 Rabbit Polyclonal Antibody