PEX13 Rabbit Polyclonal Antibody

PEX13 Polyclonal Antibody
ABP59880-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370

PEX13 Polyclonal Antibody
ABP59880-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370

PEX13 Polyclonal Antibody
ES9979-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PEX13 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEX13 Polyclonal Antibody
ES9979-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PEX13 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEX13 antibody
70R-12990	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal PEX13 antibody

PEX13 Antibody
1-CSB-PA849799LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

Polyclonal PEX13 Antibody (C-Term)
AMM07099G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PEX13 (C-Term). This antibody is tested and proven to work in the following applications:

PEX13 Polyclonal Antibody, HRP Conjugated
A69112	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

PEX13 Polyclonal Antibody, FITC Conjugated
A69113	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

PEX13 Polyclonal Antibody, Biotin Conjugated
A69114	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

Anti-PEX13 antibody
STJ70341	St John's Laboratory	100 µg	EUR 359

Anti-PEX13 antibody
STJ191137	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PEX13

PEX13 siRNA
20-abx928276	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PEX13 siRNA
20-abx928277	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PEX13 Antibody, HRP conjugated
1-CSB-PA849799LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PEX13 Antibody, FITC conjugated
1-CSB-PA849799LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PEX13 Antibody, Biotin conjugated
1-CSB-PA849799LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Peroxisomal membrane protein PEX13, Pex13 ELISA KIT
ELI-16039m	Lifescience Market	96 Tests	EUR 865

Human Peroxisomal membrane protein PEX13, PEX13 ELISA KIT
ELI-43690h	Lifescience Market	96 Tests	EUR 824

Bovine Peroxisomal membrane protein PEX13, PEX13 ELISA KIT
ELI-37434b	Lifescience Market	96 Tests	EUR 928

PEX13 cloning plasmid
CSB-CL849799HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1212 Sequence: atggcgtcccagccgccacctccccccaaaccctgggagacccgccgaattccgggagccggaccgggaccaggaccgggccccactttccaatctgctgatttgggtcctactttaatgacaagacctggacaaccagcacttaccagagtgcccccacctattcttccaaggc Show more
Description: A cloning plasmid for the PEX13 gene.

Mouse PEX13 shRNA Plasmid
20-abx977682	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PEX13 shRNA Plasmid
20-abx953466	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PEX13 Recombinant Protein (Human)
RP023128	ABM	100 ug	Ask for price

PEX13 Recombinant Protein (Mouse)
RP161381	ABM	100 ug	Ask for price

PEX13 Recombinant Protein (Rat)
RP220082	ABM	100 ug	Ask for price

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody
20-abx338710	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody
abx433119-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (HRP)
20-abx336976	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (FITC)
20-abx336977	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (Biotin)
20-abx336978	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pex13 ORF Vector (Rat) (pORF)
ORF073362	ABM	1.0 ug DNA	EUR 506

PEX13 ORF Vector (Human) (pORF)
ORF007710	ABM	1.0 ug DNA	EUR 95

Pex13 ORF Vector (Mouse) (pORF)
ORF053795	ABM	1.0 ug DNA	EUR 506

Pex13 sgRNA CRISPR Lentivector set (Rat)
K6176001	ABM	3 x 1.0 ug	EUR 339

Pex13 sgRNA CRISPR Lentivector set (Mouse)
K4637501	ABM	3 x 1.0 ug	EUR 339

PEX13 sgRNA CRISPR Lentivector set (Human)
K1629601	ABM	3 x 1.0 ug	EUR 339

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6176002	ABM	1.0 ug DNA	EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6176003	ABM	1.0 ug DNA	EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6176004	ABM	1.0 ug DNA	EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4637502	ABM	1.0 ug DNA	EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4637503	ABM	1.0 ug DNA	EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4637504	ABM	1.0 ug DNA	EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 1)
K1629602	ABM	1.0 ug DNA	EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 2)
K1629603	ABM	1.0 ug DNA	EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 3)
K1629604	ABM	1.0 ug DNA	EUR 154

PEX13 Protein Vector (Rat) (pPB-C-His)
PV293446	ABM	500 ng	EUR 603

PEX13 Protein Vector (Rat) (pPB-N-His)
PV293447	ABM	500 ng	EUR 603

PEX13 Protein Vector (Rat) (pPM-C-HA)
PV293448	ABM	500 ng	EUR 603

PEX13 Protein Vector (Rat) (pPM-C-His)
PV293449	ABM	500 ng	EUR 603

PEX13 Protein Vector (Mouse) (pPB-C-His)
PV215178	ABM	500 ng	EUR 603

PEX13 Protein Vector (Mouse) (pPB-N-His)
PV215179	ABM	500 ng	EUR 603

PEX13 Protein Vector (Mouse) (pPM-C-HA)
PV215180	ABM	500 ng	EUR 603

PEX13 Protein Vector (Mouse) (pPM-C-His)
PV215181	ABM	500 ng	EUR 603

PEX13 Protein Vector (Human) (pPB-C-His)
PV030837	ABM	500 ng	EUR 329

PEX13 Protein Vector (Human) (pPB-N-His)
PV030838	ABM	500 ng	EUR 329

PEX13 Protein Vector (Human) (pPM-C-HA)
PV030839	ABM	500 ng	EUR 329

PEX13 Protein Vector (Human) (pPM-C-His)
PV030840	ABM	500 ng	EUR 329

Pex13 3'UTR Luciferase Stable Cell Line
TU116209	ABM	1.0 ml	Ask for price

Pex13 3'UTR GFP Stable Cell Line
TU166209	ABM	1.0 ml	Ask for price

Pex13 3'UTR Luciferase Stable Cell Line
TU216094	ABM	1.0 ml	Ask for price

Pex13 3'UTR GFP Stable Cell Line
TU266094	ABM	1.0 ml	Ask for price

PEX13 3'UTR GFP Stable Cell Line
TU067754	ABM	1.0 ml	EUR 4617

PEX13 3'UTR Luciferase Stable Cell Line
TU017754	ABM	1.0 ml	EUR 4617

Recombinant Pichia pastoris PEX13 Protein (aa 252-380)
VAng-Cr6649-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3514
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein.

Recombinant Pichia pastoris PEX13 Protein (aa 252-380)
VAng-Cr6649-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2429
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein.

Recombinant Schizosaccharomyces Pombe pex13 Protein (aa 1-288)
VAng-Yyj5741-inquire	Creative Biolabs	inquire	Ask for price
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Peroxisomal membrane protein pex13 (pex13), recombinant protein.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PEX13 Rabbit Polyclonal Antibody