Biocat Net

Amine biocat 3.0

PEX16 Rabbit Polyclonal Antibody

PEX16 Polyclonal Antibody
ABP59882-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PEX16 from Human, Mouse. This PEX16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180
PEX16 Polyclonal Antibody
27412-100ul 100ul
EUR 252
PEX16 Polyclonal Antibody
27412-50ul 50ul
EUR 187
PEX16 Rabbit pAb
A10387-100ul 100 ul
EUR 308
PEX16 Rabbit pAb
A10387-200ul 200 ul
EUR 459
PEX16 Rabbit pAb
A10387-20ul 20 ul
EUR 183
PEX16 Rabbit pAb
A10387-50ul 50 ul
EUR 223
PEX16 Polyclonal Conjugated Antibody
C27412 100ul
EUR 397
PEX16 antibody
70R-19220 50 ul
EUR 435
Description: Rabbit polyclonal PEX16 antibody
PEX16 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX16. Recognizes PEX16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PEX16 Antibody
DF12168 200ul
EUR 304
Description: PEX16 antibody detects endogenous levels of PEX16.
PEX16 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PEX16. Recognizes PEX16 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
anti- PEX16 antibody
FNab06328 100µg
EUR 505.25
  • Immunogen: peroxisomal biogenesis factor 16
  • Uniprot ID: Q9Y5Y5
  • Gene ID: 9409
  • Research Area: Signal Transduction
Description: Antibody raised against PEX16
Anti-PEX16 antibody
PAab06328 100 ug
EUR 355
Anti-PEX16 antibody
STJ112423 100 µl
EUR 277
Description: The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described.
Anti-PEX16 antibody
STJ191138 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PEX16
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVT18255 2 ug
EUR 231
Bovine Peroxisomal membrane protein PEX16, PEX16 ELISA KIT
ELI-21954b 96 Tests
EUR 928
Mouse Peroxisomal membrane protein PEX16, Pex16 ELISA KIT
ELI-15239m 96 Tests
EUR 865
Human Peroxisomal membrane protein PEX16, PEX16 ELISA KIT
ELI-45034h 96 Tests
EUR 824
PEX16 Blocking Peptide
DF12168-BP 1mg
EUR 195
PEX16 cloning plasmid
CSB-CL897573HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1011
  • Sequence: atggagaagctgcggctcctgggcctccgctaccaggagtacgtgactcgtcacccggccgccacggcccagctggagacagcagtgcggggcttcagttacctgctggcaggtcgattcgccgattcgcacgagctgtcagagctggtgtactctgcctctaacctgcttgtgc
  • Show more
Description: A cloning plasmid for the PEX16 gene.
Anti-PEX16 (3E10)
YF-MA16820 200 ul
EUR 363
Description: Mouse monoclonal to PEX16
EF001690 96 Tests
EUR 689
Human PEX16 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PEX16 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PEX16 Recombinant Protein (Human)
RP023134 100 ug Ask for price
PEX16 Recombinant Protein (Rat)
RP220088 100 ug Ask for price
PEX16 Recombinant Protein (Mouse)
RP161387 100 ug Ask for price
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
abx034247-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
abx034247-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 16 (PEX16) Antibody
abx236328-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
PEX16 ORF Vector (Human) (pORF)
ORF007712 1.0 ug DNA
EUR 95
Pex16 ORF Vector (Rat) (pORF)
ORF073364 1.0 ug DNA
EUR 506
Pex16 ORF Vector (Mouse) (pORF)
ORF053797 1.0 ug DNA
EUR 506
PEX16 sgRNA CRISPR Lentivector set (Human)
K1629801 3 x 1.0 ug
EUR 339
Pex16 sgRNA CRISPR Lentivector set (Mouse)
K3261401 3 x 1.0 ug
EUR 339
Pex16 sgRNA CRISPR Lentivector set (Rat)
K7135401 3 x 1.0 ug
EUR 339
PEX16 sgRNA CRISPR Lentivector (Human) (Target 1)
K1629802 1.0 ug DNA
EUR 154
PEX16 sgRNA CRISPR Lentivector (Human) (Target 2)
K1629803 1.0 ug DNA
EUR 154
PEX16 sgRNA CRISPR Lentivector (Human) (Target 3)
K1629804 1.0 ug DNA
EUR 154
Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3261402 1.0 ug DNA
EUR 154
Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3261403 1.0 ug DNA
EUR 154
Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3261404 1.0 ug DNA
EUR 154
Pex16 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7135402 1.0 ug DNA
EUR 154
Pex16 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7135403 1.0 ug DNA
EUR 154
Pex16 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7135404 1.0 ug DNA
EUR 154
PEX16 Protein Vector (Human) (pPB-C-His)
PV030845 500 ng
EUR 329
PEX16 Protein Vector (Human) (pPB-N-His)
PV030846 500 ng
EUR 329
PEX16 Protein Vector (Human) (pPM-C-HA)
PV030847 500 ng
EUR 329
PEX16 Protein Vector (Human) (pPM-C-His)
PV030848 500 ng
EUR 329
PEX16 Protein Vector (Mouse) (pPB-C-His)
PV215186 500 ng
EUR 603
PEX16 Protein Vector (Mouse) (pPB-N-His)
PV215187 500 ng
EUR 603
PEX16 Protein Vector (Mouse) (pPM-C-HA)
PV215188 500 ng
EUR 603
PEX16 Protein Vector (Mouse) (pPM-C-His)
PV215189 500 ng
EUR 603
PEX16 Protein Vector (Rat) (pPB-C-His)
PV293454 500 ng
EUR 603
PEX16 Protein Vector (Rat) (pPB-N-His)
PV293455 500 ng
EUR 603
PEX16 Protein Vector (Rat) (pPM-C-HA)
PV293456 500 ng
EUR 603
PEX16 Protein Vector (Rat) (pPM-C-His)
PV293457 500 ng
EUR 603
Pex16 3'UTR GFP Stable Cell Line
TU166211 1.0 ml Ask for price
PEX16 3'UTR Luciferase Stable Cell Line
TU017756 1.0 ml
EUR 1394
Pex16 3'UTR Luciferase Stable Cell Line
TU116211 1.0 ml Ask for price
PEX16 3'UTR GFP Stable Cell Line
TU067756 1.0 ml
EUR 1394
Pex16 3'UTR GFP Stable Cell Line
TU266096 1.0 ml Ask for price
Pex16 3'UTR Luciferase Stable Cell Line
TU216096 1.0 ml Ask for price
Human Peroxisomal Biogenesis Factor 16 (PEX16) ELISA Kit
abx382161-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
PEX16 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV627007 1.0 ug DNA
EUR 514
PEX16 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV627011 1.0 ug DNA
EUR 514
PEX16 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV627012 1.0 ug DNA
EUR 514
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PEX16 Rabbit Polyclonal Antibody