PHC3 Polyclonal Antibody |
ES10019-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PHC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PHC3 Polyclonal Antibody |
ES10019-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PHC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PHC3 Rabbit pAb |
A14151-100ul |
Abclonal |
100 ul |
EUR 308 |
PHC3 Rabbit pAb |
A14151-200ul |
Abclonal |
200 ul |
EUR 459 |
PHC3 Rabbit pAb |
A14151-20ul |
Abclonal |
20 ul |
EUR 183 |
PHC3 Rabbit pAb |
A14151-50ul |
Abclonal |
50 ul |
EUR 223 |
PHC3 Rabbit pAb |
A6479-100ul |
Abclonal |
100 ul |
EUR 308 |
PHC3 Rabbit pAb |
A6479-200ul |
Abclonal |
200 ul |
EUR 459 |
PHC3 Rabbit pAb |
A6479-20ul |
Abclonal |
20 ul |
EUR 183 |
PHC3 Rabbit pAb |
A6479-50ul |
Abclonal |
50 ul |
EUR 223 |
PHC3 antibody |
38952-100ul |
SAB |
100ul |
EUR 252 |
PHC3 Conjugated Antibody |
C38952 |
SAB |
100ul |
EUR 397 |
Anti-PHC3 antibody |
STJ191177 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PHC3 |
PHC3 siRNA |
20-abx928420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PHC3 siRNA |
20-abx928421 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PHC3 cloning plasmid |
CSB-CL847692HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 456
- Sequence: atggcggaagcggaatttaaggaccatagtacagctatggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgt
- Show more
|
Description: A cloning plasmid for the PHC3 gene. |
PHC3 cloning plasmid |
CSB-CL847692HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 408
- Sequence: atggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgtacaggcattgcatcggccccccagctcagctgctca
- Show more
|
Description: A cloning plasmid for the PHC3 gene. |
PHC3 cloning plasmid |
CSB-CL847692HU3-10ug |
Cusabio |
10ug |
EUR 936 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2952
- Sequence: ATGGATACTGAACCAAACCCGGGAACATCTTCTGTGTCAACAACAACCAGCAGTACCACCACCACCACCATCACCACTTCCTCCTCTCGAATGCAGCAGCCACAGATCTCTGTCTACAGTGGTTCAGACCGACATGCTGTACAGGTAATTCAACAGGCATTGCATCGGCCCCCCA
- Show more
|
Description: A cloning plasmid for the PHC3 gene. |
anti-Anti-PHC3 |
YF-PA20991 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Anti-PHC3 |
Mouse PHC3 shRNA Plasmid |
20-abx982544 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PHC3 shRNA Plasmid |
20-abx962723 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyhomeotic-Like Protein 3 (PHC3) Antibody |
20-abx004967 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Polyhomeotic-Like Protein 3 (PHC3) Antibody |
20-abx142143 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Phc3 ORF Vector (Rat) (pORF) |
ORF073430 |
ABM |
1.0 ug DNA |
EUR 506 |
PHC3 ORF Vector (Human) (pORF) |
ORF014060 |
ABM |
1.0 ug DNA |
EUR 354 |
PHC3 ORF Vector (Human) (pORF) |
ORF007764 |
ABM |
1.0 ug DNA |
EUR 95 |
PHC3 ORF Vector (Human) (pORF) |
ORF007765 |
ABM |
1.0 ug DNA |
EUR 95 |
Phc3 ORF Vector (Mouse) (pORF) |
ORF053905 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 ORF Vector (Mouse) (pORF) |
ORF053906 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 ORF Vector (Mouse) (pORF) |
ORF053907 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 ORF Vector (Mouse) (pORF) |
ORF053908 |
ABM |
1.0 ug DNA |
EUR 506 |
Phc3 sgRNA CRISPR Lentivector set (Rat) |
K6539501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Phc3 sgRNA CRISPR Lentivector set (Mouse) |
K4668601 |
ABM |
3 x 1.0 ug |
EUR 339 |
PHC3 sgRNA CRISPR Lentivector set (Human) |
K1638401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Phc3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6539502 |
ABM |
1.0 ug DNA |
EUR 154 |
Phc3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6539503 |
ABM |
1.0 ug DNA |
EUR 154 |
Phc3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6539504 |
ABM |
1.0 ug DNA |
EUR 154 |
Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4668602 |
ABM |
1.0 ug DNA |
EUR 154 |
Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4668603 |
ABM |
1.0 ug DNA |
EUR 154 |
Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4668604 |
ABM |
1.0 ug DNA |
EUR 154 |
PHC3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1638402 |
ABM |
1.0 ug DNA |
EUR 154 |
PHC3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1638403 |
ABM |
1.0 ug DNA |
EUR 154 |
PHC3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1638404 |
ABM |
1.0 ug DNA |
EUR 154 |
PHC3 Protein Vector (Rat) (pPB-C-His) |
PV293718 |
ABM |
500 ng |
EUR 1166 |
PHC3 Protein Vector (Rat) (pPB-N-His) |
PV293719 |
ABM |
500 ng |
EUR 1166 |
PHC3 Protein Vector (Rat) (pPM-C-HA) |
PV293720 |
ABM |
500 ng |
EUR 1166 |
PHC3 Protein Vector (Rat) (pPM-C-His) |
PV293721 |
ABM |
500 ng |
EUR 1166 |
PHC3 Protein Vector (Human) (pPB-C-His) |
PV031053 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-N-His) |
PV031054 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-HA) |
PV031055 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-His) |
PV031056 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-C-His) |
PV031057 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-N-His) |
PV031058 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-HA) |
PV031059 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPM-C-His) |
PV031060 |
ABM |
500 ng |
EUR 329 |
PHC3 Protein Vector (Human) (pPB-C-His) |
PV056237 |
ABM |
500 ng |
EUR 481 |
PHC3 Protein Vector (Human) (pPB-N-His) |
PV056238 |
ABM |
500 ng |
EUR 481 |
PHC3 Protein Vector (Human) (pPM-C-HA) |
PV056239 |
ABM |
500 ng |
EUR 481 |
PHC3 Protein Vector (Human) (pPM-C-His) |
PV056240 |
ABM |
500 ng |
EUR 481 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
PV215618 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
PV215619 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
PV215620 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
PV215621 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
PV215622 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
PV215623 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
PV215624 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
PV215625 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
PV215626 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
PV215627 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
PV215628 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
PV215629 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-C-His) |
PV215630 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPB-N-His) |
PV215631 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-HA) |
PV215632 |
ABM |
500 ng |
EUR 1065 |
PHC3 Protein Vector (Mouse) (pPM-C-His) |
PV215633 |
ABM |
500 ng |
EUR 1065 |
Phc3 3'UTR Luciferase Stable Cell Line |
TU116279 |
ABM |
1.0 ml |
Ask for price |
Phc3 3'UTR GFP Stable Cell Line |
TU166279 |
ABM |
1.0 ml |
Ask for price |
Phc3 3'UTR Luciferase Stable Cell Line |
TU216160 |
ABM |
1.0 ml |
Ask for price |
Phc3 3'UTR GFP Stable Cell Line |
TU266160 |
ABM |
1.0 ml |
Ask for price |
PHC3 3'UTR GFP Stable Cell Line |
TU067841 |
ABM |
1.0 ml |
EUR 1521 |
PHC3 3'UTR Luciferase Stable Cell Line |
TU017841 |
ABM |
1.0 ml |
EUR 1521 |
Mouse Polyhomeotic- like protein 3, Phc3 ELISA KIT |
ELI-16013m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Polyhomeotic- like protein 3, PHC3 ELISA KIT |
ELI-43644h |
Lifescience Market |
96 Tests |
EUR 824 |
PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV713385 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV713389 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV713390 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV713391 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV713395 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV713396 |
ABM |
1.0 ug DNA |
EUR 316 |
PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV704517 |
ABM |
1.0 ug DNA |
EUR 450 |
PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV704521 |
ABM |
1.0 ug DNA |
EUR 450 |
PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV704522 |
ABM |
1.0 ug DNA |
EUR 450 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
PHC3 Rabbit Polyclonal Antibody