Biocat Net

Amine biocat 3.0

PHF6 Rabbit Polyclonal Antibody

PHF6 Polyclonal Antibody

ABP59897-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PHF6 from Human, Mouse. This PHF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370

PHF6 Polyclonal Antibody

ABP59897-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PHF6 from Human, Mouse. This PHF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370

PHF6 Polyclonal Antibody

ABP59897-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PHF6 from Human, Mouse. This PHF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370

PHF6 Polyclonal Antibody

ES9986-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PHF6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHF6 Polyclonal Antibody

ES9986-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PHF6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHF6 Rabbit pAb

A7393-100ul 100 ul
EUR 308

PHF6 Rabbit pAb

A7393-200ul 200 ul
EUR 459

PHF6 Rabbit pAb

A7393-20ul 20 ul
EUR 183

PHF6 Rabbit pAb

A7393-50ul 50 ul
EUR 223

PHF6 Rabbit pAb

A18149-100ul 100 ul
EUR 308

PHF6 Rabbit pAb

A18149-200ul 200 ul
EUR 459

PHF6 Rabbit pAb

A18149-20ul 20 ul
EUR 183

PHF6 Rabbit pAb

A18149-50ul 50 ul
EUR 223

PHF6 Rabbit pAb

A19486-100ul 100 ul Ask for price

PHF6 Rabbit pAb

A19486-200ul 200 ul Ask for price

PHF6 Rabbit pAb

A19486-20ul 20 ul Ask for price

PHF6 Rabbit pAb

A19486-50ul 50 ul
EUR 308

PHF6 antibody

20R-1278 100 ug
EUR 377
Description: Rabbit polyclonal PHF6 antibody

PHF6 antibody

20R-1279 100 ug
EUR 377
Description: Rabbit polyclonal PHF6 antibody

PHF6 antibody

70R-19258 50 ul
EUR 435
Description: Rabbit polyclonal PHF6 antibody

PHF6 Antibody

35894-100ul 100ul
EUR 252

PHF6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PHF6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PHF6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

PHF6 antibody

70R-9074 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PHF6 antibody

PHF6 Polyclonal Antibody, HRP Conjugated

A57346 100 µg
EUR 570.55
Description: The best epigenetics products

PHF6 Polyclonal Antibody, FITC Conjugated

A57347 100 µg
EUR 570.55
Description: kits suitable for this type of research

PHF6 Polyclonal Antibody, Biotin Conjugated

A57348 100 µg
EUR 570.55
Description: fast delivery possible


H-8098.0500 0.5mg
EUR 113
Description: Sum Formula: C36H60N8O9; CAS# [329897-62-3] net


H-8098.1000 1.0mg
EUR 171
Description: Sum Formula: C36H60N8O9; CAS# [329897-62-3] net

PHF6 Conjugated Antibody

C35894 100ul
EUR 397

anti- PHF6 antibody

FNab06388 100µg
EUR 585
  • Immunogen: PHD finger protein 6
  • Uniprot ID: Q8IWS0
  • Gene ID: 84295
  • Research Area: Metabolism
Description: Antibody raised against PHF6

Anti-PHF6 antibody

PAab06388 100 ug
EUR 412

Anti-PHF6 antibody

STJ11100119 100 µl
EUR 277

Anti-PHF6 antibody

STJ11100679 50 µl
EUR 287
Description: This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms.

Anti-PHF6 antibody

STJ29530 100 µl
EUR 277
Description: This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms.

Anti-PHF6 antibody

STJ191144 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PHF6


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHF6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PHF6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PHF6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PHF6 Blocking Peptide

33R-1925 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF6 antibody, catalog no. 70R-9074

PHF6 Blocking Peptide

33R-4920 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF6 antibody, catalog no. 20R-1278

PHF6 Blocking Peptide

33R-9569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF6 antibody, catalog no. 20R-1279

PHF6 cloning plasmid

CSB-CL017917HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atgtcaagctcagttgaacagaaaaaagggcctacaagacagcgcaaatgtggcttttgtaagtcaaatagagacaaggaatgtggacagttactaatatctgaaaaccagaaggtggcagcgcaccataagtgcatgctcttttcatctgctttggtatcatcacactctgataa
  • Show more
Description: A cloning plasmid for the PHF6 gene.

Acetyl-PHF6 amide

H-8112.0500 0.5mg
EUR 136
Description: Sum Formula: C38H63N9O9; CAS# [878663-43-5] net

Acetyl-PHF6 amide

H-8112.1000 1.0mg
EUR 194
Description: Sum Formula: C38H63N9O9; CAS# [878663-43-5] net


EF007338 96 Tests
EUR 689

Mouse PHF6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PHF6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Acetyl-PHF6 amide(TFA)

HY-P1675A 10mg
EUR 715

PHF6 Recombinant Protein (Human)

RP023338 100 ug Ask for price

PHF6 Recombinant Protein (Mouse)

RP161798 100 ug Ask for price

PHD Finger Protein 6 (PHF6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

PHD finger protein 6 (PHF6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phd Finger Protein 6 (PHF6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody

abx236388-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

PHD Finger Protein 6 (PHF6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHF6 ORF Vector (Human) (pORF)

ORF007780 1.0 ug DNA
EUR 95

Phf6 ORF Vector (Mouse) (pORF)

ORF053934 1.0 ug DNA
EUR 506

PHF6 ELISA Kit (Human) (OKWB00198)

OKWB00198 96 Wells
EUR 572
Description: Description of target: Transcriptional regulator that associates with ribosomal RNA promoters and suppresses ribosomal RNA (rRNA) transcription.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL

PHF6 sgRNA CRISPR Lentivector set (Human)

K1639601 3 x 1.0 ug
EUR 339

Phf6 sgRNA CRISPR Lentivector set (Mouse)

K4704701 3 x 1.0 ug
EUR 339

PHF6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1639602 1.0 ug DNA
EUR 154

PHF6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1639603 1.0 ug DNA
EUR 154

PHF6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1639604 1.0 ug DNA
EUR 154

Phf6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4704702 1.0 ug DNA
EUR 154

Phf6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4704703 1.0 ug DNA
EUR 154

Phf6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4704704 1.0 ug DNA
EUR 154

PHF6 Protein Vector (Human) (pPB-C-His)

PV031117 500 ng
EUR 329

PHF6 Protein Vector (Human) (pPB-N-His)

PV031118 500 ng
EUR 329

PHF6 Protein Vector (Human) (pPM-C-HA)

PV031119 500 ng
EUR 329

PHF6 Protein Vector (Human) (pPM-C-His)

PV031120 500 ng
EUR 329

PHF6 Protein Vector (Mouse) (pPB-C-His)

PV215734 500 ng
EUR 603

PHF6 Protein Vector (Mouse) (pPB-N-His)

PV215735 500 ng
EUR 603

PHF6 Protein Vector (Mouse) (pPM-C-HA)

PV215736 500 ng
EUR 603

PHF6 Protein Vector (Mouse) (pPM-C-His)

PV215737 500 ng
EUR 603

Phf6 3'UTR Luciferase Stable Cell Line

TU116299 1.0 ml Ask for price

Phf6 3'UTR GFP Stable Cell Line

TU166299 1.0 ml Ask for price

PHF6 3'UTR GFP Stable Cell Line

TU067855 1.0 ml
EUR 4617

PHF6 3'UTR Luciferase Stable Cell Line

TU017855 1.0 ml
EUR 4617

Human PHD finger protein 6 (PHF6) ELISA Kit

abx257269-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human PHF6(PHD finger protein 6) ELISA Kit

EH4132 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q8IWS0
  • Alias: PHD-like zinc finger protein/CENP-31/KIAA1823
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human PHD finger protein 6, PHF6 ELISA KIT

ELI-44987h 96 Tests
EUR 824

Mouse PHD finger protein 6, Phf6 ELISA KIT

ELI-45028m 96 Tests
EUR 865

Bovine PHD finger protein 6, PHF6 ELISA KIT

ELI-38008b 96 Tests
EUR 928

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PHF6 Rabbit Polyclonal Antibody