PIGQ Polyclonal Antibody |
ABP59913-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of PIGQ from Human, Mouse. This PIGQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210 |
PIGQ Rabbit pAb |
A17044-100ul |
Abclonal |
100 ul |
EUR 308 |
PIGQ Rabbit pAb |
A17044-200ul |
Abclonal |
200 ul |
EUR 459 |
PIGQ Rabbit pAb |
A17044-20ul |
Abclonal |
20 ul |
EUR 183 |
PIGQ Rabbit pAb |
A17044-50ul |
Abclonal |
50 ul |
EUR 223 |
PIGQ antibody |
70R-6645 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ |
PIGQ antibody |
70R-6647 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ |
PIGQ Antibody |
46128-100ul |
SAB |
100ul |
EUR 252 |
PIGQ Antibody |
46128-50ul |
SAB |
50ul |
EUR 187 |
PIGQ Antibody |
DF9745 |
Affbiotech |
200ul |
EUR 304 |
Description: PIGQ Antibody detects endogenous levels of total PIGQ. |
PIGQ Antibody |
1-CSB-PA883583LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
PIGQ Conjugated Antibody |
C46128 |
SAB |
100ul |
EUR 397 |
Anti-PIGQ antibody |
STJ191150 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PIGQ |
PIGQ siRNA |
20-abx928578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGQ siRNA |
20-abx928579 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGQ Antibody, HRP conjugated |
1-CSB-PA883583LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PIGQ Antibody, FITC conjugated |
1-CSB-PA883583LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PIGQ Antibody, Biotin conjugated |
1-CSB-PA883583LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PIGQ Blocking Peptide |
33R-7400 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6647 |
PIGQ Blocking Peptide |
33R-9665 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6645 |
PIGQ cloning plasmid |
CSB-CL883583HU-10ug |
Cusabio |
10ug |
EUR 749 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2283
- Sequence: atggtgctcaaggccttcttccccacgtgctgcgtctcgacggacagcgggctgctggtgggacggtgggtgccggagcagagcagcgccgtggtcctggcggtcctgcactttcccttcatccccatccaggtcaagcagctcctggcccaggtgcggcaggccagccaggtgg
- Show more
|
Description: A cloning plasmid for the PIGQ gene. |
PIGQ Blocking Peptide |
DF9745-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-PIGQ (2B7) |
YF-MA16652 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PIGQ |
Human PIGQ shRNA Plasmid |
20-abx956004 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PIGQ shRNA Plasmid |
20-abx970628 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PIGQ Recombinant Protein (Human) |
RP023476 |
ABM |
100 ug |
Ask for price |
PIGQ Recombinant Protein (Rat) |
RP220490 |
ABM |
100 ug |
Ask for price |
PIGQ Recombinant Protein (Mouse) |
RP162071 |
ABM |
100 ug |
Ask for price |
Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit Q (PIGQ) Antibody |
20-abx217768 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGQ ORF Vector (Human) (pORF) |
ORF007826 |
ABM |
1.0 ug DNA |
EUR 95 |
Pigq ORF Vector (Rat) (pORF) |
ORF073498 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigq ORF Vector (Mouse) (pORF) |
ORF054025 |
ABM |
1.0 ug DNA |
EUR 506 |
PIGQ sgRNA CRISPR Lentivector set (Human) |
K1648101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pigq sgRNA CRISPR Lentivector set (Mouse) |
K4911601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pigq sgRNA CRISPR Lentivector set (Rat) |
K7371601 |
ABM |
3 x 1.0 ug |
EUR 339 |
PIGQ sgRNA CRISPR Lentivector (Human) (Target 1) |
K1648102 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ sgRNA CRISPR Lentivector (Human) (Target 2) |
K1648103 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ sgRNA CRISPR Lentivector (Human) (Target 3) |
K1648104 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4911602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4911603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4911604 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7371602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7371603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7371604 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ Protein Vector (Human) (pPB-C-His) |
PV031301 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Human) (pPB-N-His) |
PV031302 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Human) (pPM-C-HA) |
PV031303 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Human) (pPM-C-His) |
PV031304 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Mouse) (pPB-C-His) |
PV216098 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Mouse) (pPB-N-His) |
PV216099 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Mouse) (pPM-C-HA) |
PV216100 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Mouse) (pPM-C-His) |
PV216101 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPB-C-His) |
PV293990 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPB-N-His) |
PV293991 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPM-C-HA) |
PV293992 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPM-C-His) |
PV293993 |
ABM |
500 ng |
EUR 603 |
Pigq 3'UTR GFP Stable Cell Line |
TU166357 |
ABM |
1.0 ml |
Ask for price |
PIGQ 3'UTR Luciferase Stable Cell Line |
TU017941 |
ABM |
1.0 ml |
EUR 1394 |
Pigq 3'UTR Luciferase Stable Cell Line |
TU116357 |
ABM |
1.0 ml |
Ask for price |
PIGQ 3'UTR GFP Stable Cell Line |
TU067941 |
ABM |
1.0 ml |
EUR 1394 |
Pigq 3'UTR GFP Stable Cell Line |
TU266235 |
ABM |
1.0 ml |
Ask for price |
Pigq 3'UTR Luciferase Stable Cell Line |
TU216235 |
ABM |
1.0 ml |
Ask for price |
PIGQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV634447 |
ABM |
1.0 ug DNA |
EUR 682 |
PIGQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV634451 |
ABM |
1.0 ug DNA |
EUR 682 |
PIGQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV634452 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PIGQ Rabbit Polyclonal Antibody