Biocat Net

Amine biocat 3.0

PIGQ Rabbit Polyclonal Antibody

PIGQ Polyclonal Antibody

ABP59913-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of PIGQ from Human, Mouse. This PIGQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210

PIGQ Rabbit pAb

A17044-100ul 100 ul
EUR 308

PIGQ Rabbit pAb

A17044-200ul 200 ul
EUR 459

PIGQ Rabbit pAb

A17044-20ul 20 ul
EUR 183

PIGQ Rabbit pAb

A17044-50ul 50 ul
EUR 223

PIGQ Antibody

ABD9745 100 ug
EUR 438

PIGQ antibody

70R-6645 50 ug
EUR 467
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ

PIGQ antibody

70R-6647 50 ug
EUR 467
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ

PIGQ Antibody

46128-100ul 100ul
EUR 252

PIGQ Antibody

46128-50ul 50ul
EUR 187

PIGQ Antibody

DF9745 200ul
EUR 304
Description: PIGQ Antibody detects endogenous levels of total PIGQ.

PIGQ Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PIGQ Conjugated Antibody

C46128 100ul
EUR 397

Anti-PIGQ antibody

STJ119318 100 µl
EUR 277

Anti-PIGQ antibody

STJ191150 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGQ


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGQ Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGQ Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGQ Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGQ Blocking Peptide

33R-7400 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6647

PIGQ Blocking Peptide

33R-9665 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6645

PIGQ cloning plasmid

CSB-CL883583HU-10ug 10ug
EUR 749
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: atggtgctcaaggccttcttccccacgtgctgcgtctcgacggacagcgggctgctggtgggacggtgggtgccggagcagagcagcgccgtggtcctggcggtcctgcactttcccttcatccccatccaggtcaagcagctcctggcccaggtgcggcaggccagccaggtgg
  • Show more
Description: A cloning plasmid for the PIGQ gene.

PIGQ Blocking Peptide

DF9745-BP 1mg
EUR 195

pENTR223-PIGQ vector

PVT11790 2 ug
EUR 304

Anti-PIGQ (2B7)

YF-MA16652 100 ug
EUR 363
Description: Mouse monoclonal to PIGQ


ELI-43655h 96 Tests
EUR 824

Mouse Pigq ELISA KIT

ELI-43656m 96 Tests
EUR 865

Human PIGQ shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PIGQ shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGQ Recombinant Protein (Human)

RP023476 100 ug Ask for price

PIGQ Recombinant Protein (Rat)

RP220490 100 ug Ask for price

PIGQ Recombinant Protein (Mouse)

RP162071 100 ug Ask for price

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit Q (PIGQ) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PIGQ ORF Vector (Human) (pORF)

ORF007826 1.0 ug DNA
EUR 95

Pigq ORF Vector (Rat) (pORF)

ORF073498 1.0 ug DNA
EUR 506

Pigq ORF Vector (Mouse) (pORF)

ORF054025 1.0 ug DNA
EUR 506

PIGQ sgRNA CRISPR Lentivector set (Human)

K1648101 3 x 1.0 ug
EUR 339

Pigq sgRNA CRISPR Lentivector set (Mouse)

K4911601 3 x 1.0 ug
EUR 339

Pigq sgRNA CRISPR Lentivector set (Rat)

K7371601 3 x 1.0 ug
EUR 339

PIGQ sgRNA CRISPR Lentivector (Human) (Target 1)

K1648102 1.0 ug DNA
EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 2)

K1648103 1.0 ug DNA
EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 3)

K1648104 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4911602 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4911603 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4911604 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 1)

K7371602 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 2)

K7371603 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 3)

K7371604 1.0 ug DNA
EUR 154

PIGQ Protein Vector (Human) (pPB-C-His)

PV031301 500 ng
EUR 329

PIGQ Protein Vector (Human) (pPB-N-His)

PV031302 500 ng
EUR 329

PIGQ Protein Vector (Human) (pPM-C-HA)

PV031303 500 ng
EUR 329

PIGQ Protein Vector (Human) (pPM-C-His)

PV031304 500 ng
EUR 329

PIGQ Protein Vector (Mouse) (pPB-C-His)

PV216098 500 ng
EUR 603

PIGQ Protein Vector (Mouse) (pPB-N-His)

PV216099 500 ng
EUR 603

PIGQ Protein Vector (Mouse) (pPM-C-HA)

PV216100 500 ng
EUR 603

PIGQ Protein Vector (Mouse) (pPM-C-His)

PV216101 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPB-C-His)

PV293990 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPB-N-His)

PV293991 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPM-C-HA)

PV293992 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPM-C-His)

PV293993 500 ng
EUR 603

Pigq 3'UTR GFP Stable Cell Line

TU166357 1.0 ml Ask for price

PIGQ 3'UTR Luciferase Stable Cell Line

TU017941 1.0 ml
EUR 1394

Pigq 3'UTR Luciferase Stable Cell Line

TU116357 1.0 ml Ask for price

PIGQ 3'UTR GFP Stable Cell Line

TU067941 1.0 ml
EUR 1394

Pigq 3'UTR GFP Stable Cell Line

TU266235 1.0 ml Ask for price

Pigq 3'UTR Luciferase Stable Cell Line

TU216235 1.0 ml Ask for price

PIGQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV634447 1.0 ug DNA
EUR 682

PIGQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV634451 1.0 ug DNA
EUR 682

PIGQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV634452 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PIGQ Rabbit Polyclonal Antibody