PLTP Polyclonal Antibody |
ES10007-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLTP Polyclonal Antibody |
ES10007-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLTP Polyclonal Antibody |
ABP59951-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 |
PLTP Polyclonal Antibody |
ABP59951-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 |
PLTP Polyclonal Antibody |
ABP59951-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 |
PLTP Polyclonal Antibody |
A53320 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
DLR-PLTP-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
DLR-PLTP-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
DLR-PLTP-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
DLR-PLTP-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
PLTP Rabbit pAb |
A5628-100ul |
Abclonal |
100 ul |
EUR 308 |
PLTP Rabbit pAb |
A5628-200ul |
Abclonal |
200 ul |
EUR 459 |
PLTP Rabbit pAb |
A5628-20ul |
Abclonal |
20 ul |
EUR 183 |
PLTP Rabbit pAb |
A5628-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit PLTP ELISA Kit |
ERTP0138 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal PLTP Antibody (aa470-490) |
AMR09388G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (aa470-490). This antibody is tested and proven to work in the following applications: |
Polyclonal PLTP Antibody (C-term) |
AMR09389G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (C-term). This antibody is tested and proven to work in the following applications: |
PLTP Polyclonal Antibody, Biotin Conjugated |
A53317 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PLTP Polyclonal Antibody, FITC Conjugated |
A53318 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PLTP Polyclonal Antibody, HRP Conjugated |
A53319 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PLTP Antibody |
32933-100ul |
SAB |
100ul |
EUR 252 |
PLTP antibody |
70R-11938 |
Fitzgerald |
100 ug |
EUR 418 |
Description: Rabbit polyclonal PLTP antibody |
PLTP antibody |
70R-10288 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal PLTP antibody |
PLTP Antibody |
DF7426 |
Affbiotech |
200ul |
EUR 304 |
Description: PLTP Antibody detects endogenous levels of total PLTP. |
PLTP Antibody |
1-CSB-PA253412 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
PLTP Antibody |
1-CSB-PA018212EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PLTP Conjugated Antibody |
C32933 |
SAB |
100ul |
EUR 397 |
Anti-PLTP Antibody |
PA2228 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-PLTP antibody |
STJ27595 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. |
Anti-PLTP antibody |
STJ191165 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PLTP |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse) |
4-PAC728Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP) |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat) |
4-PAC728Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP) |
PLTP siRNA |
20-abx928999 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLTP siRNA |
20-abx929000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PLTP |
YF-PA13839 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PLTP |
anti-PLTP |
YF-PA13840 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PLTP |
anti-PLTP |
YF-PA24404 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PLTP |
PLTP Antibody, HRP conjugated |
1-CSB-PA018212EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PLTP Antibody, FITC conjugated |
1-CSB-PA018212EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PLTP Antibody, Biotin conjugated |
1-CSB-PA018212ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC |
4-PAC728Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC728Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Cy3 |
4-PAC728Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), FITC |
4-PAC728Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), HRP |
4-PAC728Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), PE |
4-PAC728Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC |
4-PAC728Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Biotinylated |
4-PAC728Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Cy3 |
4-PAC728Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), FITC |
4-PAC728Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), HRP |
4-PAC728Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), PE |
4-PAC728Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE. |
Rabbit Phospholipid Transfer Protein (PLTP) ELISA Kit |
abx363002-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
PLTP cloning plasmid |
CSB-CL018212HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1482
- Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
- Show more
|
Description: A cloning plasmid for the PLTP gene. |
PLTP cloning plasmid |
CSB-CL018212HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1326
- Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagagttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
- Show more
|
Description: A cloning plasmid for the PLTP gene. |
PLTP Blocking Peptide |
33R-6693 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-10288 |
PLTP Blocking Peptide |
33R-10824 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-11938 |
PLTP Blocking Peptide |
3595BP-50 |
Biovision |
|
EUR 153 |
PLTP Blocking Peptide |
DF7426-BP |
Affbiotech |
1mg |
EUR 195 |
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx131266 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx131267 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx142148 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
abx146426-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
abx033529-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
abx033529-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx004303 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx174059 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx174060 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx178016 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx178017 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx212015 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC728Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC728Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7. |
Human PLTP ELISA Kit |
EHP0138 |
Abclonal |
96Tests |
EUR 521 |
Goat PLTP ELISA Kit |
EGTP0138 |
Abclonal |
96Tests |
EUR 521 |
Bovine PLTP ELISA Kit |
EBP0138 |
Abclonal |
96Tests |
EUR 521 |
Chicken PLTP ELISA Kit |
ECKP0138 |
Abclonal |
96Tests |
EUR 521 |
Anserini PLTP ELISA Kit |
EAP0138 |
Abclonal |
96Tests |
EUR 521 |
Canine PLTP ELISA Kit |
ECP0138 |
Abclonal |
96Tests |
EUR 521 |
Porcine PLTP ELISA Kit |
EPP0138 |
Abclonal |
96Tests |
EUR 521 |
Rat PLTP ELISA Kit |
ERP0138 |
Abclonal |
96Tests |
EUR 521 |
Sheep PLTP ELISA Kit |
ESP0138 |
Abclonal |
96Tests |
EUR 521 |
Monkey PLTP ELISA Kit |
EMKP0138 |
Abclonal |
96Tests |
EUR 521 |
Mouse PLTP ELISA Kit |
EMP0138 |
Abclonal |
96Tests |
EUR 521 |
Human PLTP shRNA Plasmid |
20-abx953598 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PLTP shRNA Plasmid |
20-abx972110 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PLTP Recombinant Protein (Human) |
RP023854 |
ABM |
100 ug |
Ask for price |
PLTP Recombinant Protein (Human) |
RP023857 |
ABM |
100 ug |
Ask for price |
PLTP Recombinant Protein (Rat) |
RP221072 |
ABM |
100 ug |
Ask for price |
PLTP Recombinant Protein (Mouse) |
RP162998 |
ABM |
100 ug |
Ask for price |
Anti-PLTP (2F3-G4) |
YF-MA10707 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PLTP |
Mouse PLTP PicoKine ELISA Kit |
EK1368 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse PLTP in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Mouse PLTP |
EK5632 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse PLTP in samples from serum, plasma, tissue homogenates and other biological fluids. |
Guinea Pig PLTP ELISA Kit |
EGP0138 |
Abclonal |
96Tests |
EUR 521 |
PLTP Inhibitor Drug Screening Kit |
55R-1448 |
Fitzgerald |
100 assays |
EUR 920 |
Description: Screening Kit for detection of PLTP Inhibitor in the research laboratory |
PLTP Activity Fluorometric Assay Kit |
K2087-100 |
ApexBio |
100 assays |
EUR 669 |
Human Phospholipid transfer protein (PLTP) |
1-CSB-YP018212HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 55.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in Yeast |
Human Phospholipid transfer protein (PLTP) |
1-CSB-EP018212HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 80.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in E.coli |
PLTP ORF Vector (Human) (pORF) |
ORF007952 |
ABM |
1.0 ug DNA |
EUR 95 |
PLTP ORF Vector (Human) (pORF) |
ORF007953 |
ABM |
1.0 ug DNA |
EUR 95 |
Pltp ORF Vector (Rat) (pORF) |
ORF073692 |
ABM |
1.0 ug DNA |
EUR 506 |
Pltp ORF Vector (Mouse) (pORF) |
ORF054334 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Phospholipid Transfer Protein (PLTP) |
4-RPC728Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P55065
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.4kDa
- Isoelectric Point: 10.1
|
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli |
Recombinant Phospholipid Transfer Protein (PLTP) |
4-RPC728Ra01 |
Cloud-Clone |
-
EUR 469.15
-
EUR 229.00
-
EUR 1484.32
-
EUR 561.44
-
EUR 1022.88
-
EUR 377.00
-
EUR 3560.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: E9PSP1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli |
Monoclonal PLTP Antibody (monoclonal) (M01), Clone: 2F3-G4 |
AMR09390G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PLTP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F3-G4. This antibody is applicable in WB and IHC |
Human Phospholipid Transfer Protein (PLTP) Protein |
20-abx654736 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Phospholipid Transfer Protein (PLTP) Protein |
20-abx650146 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Phospholipid Transfer Protein (PLTP) Protein |
20-abx650147 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PLTP sgRNA CRISPR Lentivector set (Human) |
K1671101 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLTP Activity Fluorometric Assay Kit II |
K593-100 |
Biovision |
|
EUR 588 |
Pltp sgRNA CRISPR Lentivector set (Mouse) |
K4829701 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLTP Inhibitor Drug Screening Kit (Fluorometric) |
K605-100 |
Biovision |
|
EUR 615 |
Pltp sgRNA CRISPR Lentivector set (Rat) |
K6759701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pig Phospholipid Transfer Protein (PLTP) ELISA Kit |
abx361115-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human PLTP(Phospholipid Transfer Protein) ELISA Kit |
EH3621 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P55058
- Alias: PLTP/HDLCQ9/Lipid transfer protein II/phospholipid transfer protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Mouse Phospholipid transfer protein, Pltp ELISA KIT |
ELI-21705m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Phospholipid transfer protein, PLTP ELISA KIT |
ELI-15355h |
Lifescience Market |
96 Tests |
EUR 824 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
20-abx155987 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit |
20-abx156962 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
20-abx152788 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Monkey Phospholipid Transfer Protein (PLTP) ELISA Kit |
abx359185-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Phospholipid Transfer Protein (PLTP) CLIA Kit |
20-abx493861 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Phospholipid Transfer Protein (PLTP) CLIA Kit |
20-abx493862 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
PLTP Rabbit Polyclonal Antibody