PPIG Rabbit Polyclonal Antibody

PPIG Polyclonal Antibody
ES9975-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PPIG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPIG Polyclonal Antibody
ES9975-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PPIG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPIG Rabbit pAb
A0429-100ul	Abclonal	100 ul	EUR 308

PPIG Rabbit pAb
A0429-200ul	Abclonal	200 ul	EUR 459

PPIG Rabbit pAb
A0429-20ul	Abclonal	20 ul	EUR 183

PPIG Rabbit pAb
A0429-50ul	Abclonal	50 ul	EUR 223

PPIG antibody
70R-19450	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PPIG antibody

PPIG Antibody
43878-100ul	SAB	100ul	EUR 252

PPIG Antibody
AF4766	Affbiotech	200ul	EUR 376
Description: PPIG Antibody detects endogenous levels of PPIG.

PPIG Antibody
1-CSB-PA018477GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PPIG. Recognizes PPIG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Polyclonal PPIG Antibody (internal region)
AMM07280G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PPIG (internal region). This antibody is tested and proven to work in the following applications:

Phospho-PPIG-S376 Rabbit pAb
AP0842-100ul	Abclonal	100 ul	EUR 384

Phospho-PPIG-S376 Rabbit pAb
AP0842-200ul	Abclonal	200 ul	EUR 554

Phospho-PPIG-S376 Rabbit pAb
AP0842-20ul	Abclonal	20 ul	EUR 183

Phospho-PPIG-S376 Rabbit pAb
AP0842-50ul	Abclonal	50 ul	EUR 265

PPIG Conjugated Antibody
C43878	SAB	100ul	EUR 397

anti- PPIG antibody
FNab06677	FN Test	100µg	EUR 548.75
Immunogen: peptidylprolyl isomerase G(cyclophilin G) Uniprot ID: Q13427 Gene ID: 9360 Research Area: Metabolism
Description: Antibody raised against PPIG

Anti-PPIG Antibody
PA2152	BosterBio	100ug/vial	EUR 294

Anti-PPIG antibody
PAab06677	Lifescience Market	100 ug	EUR 386

Anti-PPIG antibody
STJ114882	St John's Laboratory	100 µl	EUR 277

Anti-PPIG antibody
STJ72047	St John's Laboratory	100 µg	EUR 359

Anti-PPIG antibody
STJ191133	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PPIG

PPIG siRNA
20-abx904162	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPIG siRNA
20-abx929406	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPIG siRNA
20-abx929407	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PPIG
YF-PA16240	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PPIG

anti-PPIG
YF-PA16241	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to PPIG

anti-PPIG
YF-PA25318	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PPIG

Phospho-PPIG (Ser376) Antibody
AF4466	Affbiotech	200ul	EUR 376
Description: Phospho-PPIG (Ser376) Antibody detects endogenous levels of PPIG only when phosphorylated at Ser376.

Phospho- PPIG (Ser376) Antibody
ABF3708	Lifescience Market	100 ug	EUR 438

PPIG Blocking Peptide
AF4766-BP	Affbiotech	1mg	EUR 195

PPIG cloning plasmid
CSB-CL615686HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1074 Sequence: atgggaataaaggttcaacgtcctcgatgtttttttgacattgccattaacaatcaacctgctggaagagttgtctttgaattattttctgatgtgtgccccaaaacatgcgagaactttcgttgtctttgtacaggtgaaaaggggaccgggaaatcaactcagaaaccattac Show more
Description: A cloning plasmid for the PPIG gene.

PPIG cloning plasmid
CSB-CL615686HU2-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2220 Sequence: ATGGGAATAAAGGTTCAACGTCCTCGATGTTTTTTTGACATTGCCATTAACAATCAACCTGCTGGAAGAGTTGTCTTTGAATTATTTTCTGATGTGTGCCCCAAAACATGCGAGAACTTTCGTTGTCTTTGTACAGGTGAAAAGGGGACCGGGAAATCAACTCAGAAACCATTAC Show more
Description: A cloning plasmid for the PPIG gene.

pCMV-SPORT6-PPIG
PVT13862	Lifescience Market	2 ug	EUR 391

Anti-PPIG (4F8)
YF-MA11167	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPIG

Anti-PPIG (4F7)
YF-MA16800	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPIG

Human Cyclophilin G (PPIG) Antibody
30027-05111	AssayPro	150 ug	EUR 261

Peptidylprolyl Isomerase G (PPIG) Antibody
abx236677-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Peptidylprolyl Isomerase G (PPIG) Antibody
abx431741-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Peptidylprolyl Isomerase G (PPIG) Antibody
20-abx000715	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-Phospho-PPIG-S376 antibody
STJ11100983	St John's Laboratory	100 µl	EUR 393

PPIG ELISA KIT|Human
EF001975	Lifescience Market	96 Tests	EUR 689

Rat PPIG shRNA Plasmid
20-abx986822	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PPIG shRNA Plasmid
20-abx956196	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PPIG shRNA Plasmid
20-abx981607	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PPIG Recombinant Protein (Human)
RP024277	ABM	100 ug	Ask for price

PPIG Recombinant Protein (Human)
RP042397	ABM	100 ug	Ask for price

PPIG Recombinant Protein (Mouse)
RP163739	ABM	100 ug	Ask for price

PPIG Recombinant Protein (Rat)
RP221624	ABM	100 ug	Ask for price

Human Cyclophilin G (PPIG) Antibody (Biotin Conjugate)
30027-05121	AssayPro	150 ug	EUR 369

Monoclonal PPIG Antibody (monoclonal) (M02), Clone: 4F8
AMM07281G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PPIG (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4F8. This antibody is applicable in WB, IHC and IF, E

Phospho-PPIG (Ser376) Blocking Peptide
AF4466-BP	Affbiotech	1mg	EUR 195

Ppig ORF Vector (Rat) (pORF)
ORF073876	ABM	1.0 ug DNA	EUR 506

PPIG ORF Vector (Human) (pORF)
ORF014133	ABM	1.0 ug DNA	EUR 354

PPIG ORF Vector (Human) (pORF)
ORF008093	ABM	1.0 ug DNA	EUR 95

Ppig ORF Vector (Mouse) (pORF)
ORF054581	ABM	1.0 ug DNA	EUR 506

Human Cyclophilin G (PPIG) AssayLite Antibody (FITC Conjugate)
30027-05141	AssayPro	150 ug	EUR 428

Human Cyclophilin G (PPIG) AssayLite Antibody (RPE Conjugate)
30027-05151	AssayPro	150 ug	EUR 428

Human Cyclophilin G (PPIG) AssayLite Antibody (APC Conjugate)
30027-05161	AssayPro	150 ug	EUR 428

Human Cyclophilin G (PPIG) AssayLite Antibody (PerCP Conjugate)
30027-05171	AssayPro	150 ug	EUR 471

Ppig sgRNA CRISPR Lentivector set (Mouse)
K4914901	ABM	3 x 1.0 ug	EUR 339

Ppig sgRNA CRISPR Lentivector set (Rat)
K6975001	ABM	3 x 1.0 ug	EUR 339

PPIG sgRNA CRISPR Lentivector set (Human)
K1699101	ABM	3 x 1.0 ug	EUR 339

Human Peptidylprolyl Isomerase G (PPIG) ELISA Kit
abx382392-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Ppig sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4914902	ABM	1.0 ug DNA	EUR 154

Ppig sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4914903	ABM	1.0 ug DNA	EUR 154

Ppig sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4914904	ABM	1.0 ug DNA	EUR 154

Human Cyclophilin G (PPIG) AssayMax ELISA Kit
EP6520-1	AssayPro	96 Well Plate	EUR 477

Ppig sgRNA CRISPR Lentivector (Rat) (Target 1)
K6975002	ABM	1.0 ug DNA	EUR 154

Ppig sgRNA CRISPR Lentivector (Rat) (Target 2)
K6975003	ABM	1.0 ug DNA	EUR 154

Ppig sgRNA CRISPR Lentivector (Rat) (Target 3)
K6975004	ABM	1.0 ug DNA	EUR 154

PPIG sgRNA CRISPR Lentivector (Human) (Target 1)
K1699102	ABM	1.0 ug DNA	EUR 154

PPIG sgRNA CRISPR Lentivector (Human) (Target 2)
K1699103	ABM	1.0 ug DNA	EUR 154

PPIG sgRNA CRISPR Lentivector (Human) (Target 3)
K1699104	ABM	1.0 ug DNA	EUR 154

PPIG Protein Vector (Rat) (pPB-C-His)
PV295502	ABM	500 ng	EUR 1166

PPIG Protein Vector (Rat) (pPB-N-His)
PV295503	ABM	500 ng	EUR 1166

PPIG Protein Vector (Rat) (pPM-C-HA)
PV295504	ABM	500 ng	EUR 1166

PPIG Protein Vector (Rat) (pPM-C-His)
PV295505	ABM	500 ng	EUR 1166

PPIG Protein Vector (Human) (pPB-C-His)
PV032369	ABM	500 ng	EUR 329

PPIG Protein Vector (Human) (pPB-N-His)
PV032370	ABM	500 ng	EUR 329

PPIG Protein Vector (Human) (pPM-C-HA)
PV032371	ABM	500 ng	EUR 329

PPIG Protein Vector (Human) (pPM-C-His)
PV032372	ABM	500 ng	EUR 329

PPIG Protein Vector (Human) (pPB-C-His)
PV056529	ABM	500 ng	EUR 481

PPIG Protein Vector (Human) (pPB-N-His)
PV056530	ABM	500 ng	EUR 481

PPIG Protein Vector (Human) (pPM-C-HA)
PV056531	ABM	500 ng	EUR 481

PPIG Protein Vector (Human) (pPM-C-His)
PV056532	ABM	500 ng	EUR 481

PPIG Protein Vector (Mouse) (pPB-C-His)
PV218322	ABM	500 ng	EUR 1065

PPIG Protein Vector (Mouse) (pPB-N-His)
PV218323	ABM	500 ng	EUR 1065

PPIG Protein Vector (Mouse) (pPM-C-HA)
PV218324	ABM	500 ng	EUR 1065

PPIG Protein Vector (Mouse) (pPM-C-His)
PV218325	ABM	500 ng	EUR 1065

Ppig 3'UTR Luciferase Stable Cell Line
TU116776	ABM	1.0 ml	Ask for price

Ppig 3'UTR GFP Stable Cell Line
TU166776	ABM	1.0 ml	Ask for price

Ppig 3'UTR Luciferase Stable Cell Line
TU216624	ABM	1.0 ml	Ask for price

Ppig 3'UTR GFP Stable Cell Line
TU266624	ABM	1.0 ml	Ask for price

PPIG 3'UTR GFP Stable Cell Line
TU068588	ABM	1.0 ml	EUR 2333

PPIG 3'UTR Luciferase Stable Cell Line
TU018588	ABM	1.0 ml	EUR 2333

PPIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704175	ABM	1.0 ug DNA	EUR 450

PPIG Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704179	ABM	1.0 ug DNA	EUR 450

PPIG Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV704180	ABM	1.0 ug DNA	EUR 450

PPIG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV672229	ABM	1.0 ug DNA	EUR 1355

PPIG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV672233	ABM	1.0 ug DNA	EUR 1355

PPIG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV672234	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

PPIG Rabbit Polyclonal Antibody