PPIG Polyclonal Antibody |
ABP59982-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of PPIG from Human, Mouse, Rat. This PPIG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370 |
PPIG Polyclonal Antibody |
ABP59982-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of PPIG from Human, Mouse, Rat. This PPIG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370 |
PPIG Rabbit pAb |
A0429-100ul |
Abclonal |
100 ul |
EUR 308 |
PPIG Rabbit pAb |
A0429-200ul |
Abclonal |
200 ul |
EUR 459 |
PPIG Rabbit pAb |
A0429-20ul |
Abclonal |
20 ul |
EUR 183 |
PPIG Rabbit pAb |
A0429-50ul |
Abclonal |
50 ul |
EUR 223 |
PPIG Antibody |
AF4766 |
Affbiotech |
200ul |
EUR 376 |
Description: PPIG Antibody detects endogenous levels of PPIG. |
PPIG Antibody |
43878-100ul |
SAB |
100ul |
EUR 252 |
PPIG antibody |
70R-19450 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PPIG antibody |
PPIG Antibody |
1-CSB-PA018477GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PPIG. Recognizes PPIG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
Polyclonal PPIG Antibody (internal region) |
AMM07280G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PPIG (internal region). This antibody is tested and proven to work in the following applications: |
Phospho-PPIG-S376 Rabbit pAb |
AP0842-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-PPIG-S376 Rabbit pAb |
AP0842-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-PPIG-S376 Rabbit pAb |
AP0842-20ul |
Abclonal |
20 ul |
EUR 183 |
Phospho-PPIG-S376 Rabbit pAb |
AP0842-50ul |
Abclonal |
50 ul |
EUR 265 |
PPIG Conjugated Antibody |
C43878 |
SAB |
100ul |
EUR 397 |
anti- PPIG antibody |
FNab06677 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: peptidylprolyl isomerase G(cyclophilin G)
- Uniprot ID: Q13427
- Gene ID: 9360
- Research Area: Metabolism
|
Description: Antibody raised against PPIG |
Anti-PPIG Antibody |
PA2152 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-PPIG antibody |
STJ191133 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PPIG |
PPIG siRNA |
20-abx904162 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPIG siRNA |
20-abx929406 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPIG siRNA |
20-abx929407 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PPIG |
YF-PA16240 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PPIG |
anti-PPIG |
YF-PA16241 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PPIG |
anti-PPIG |
YF-PA25318 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PPIG |
Phospho-PPIG (Ser376) Antibody |
AF4466 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-PPIG (Ser376) Antibody detects endogenous levels of PPIG only when phosphorylated at Ser376. |
PPIG Blocking Peptide |
AF4766-BP |
Affbiotech |
1mg |
EUR 195 |
PPIG cloning plasmid |
CSB-CL615686HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1074
- Sequence: atgggaataaaggttcaacgtcctcgatgtttttttgacattgccattaacaatcaacctgctggaagagttgtctttgaattattttctgatgtgtgccccaaaacatgcgagaactttcgttgtctttgtacaggtgaaaaggggaccgggaaatcaactcagaaaccattac
- Show more
|
Description: A cloning plasmid for the PPIG gene. |
PPIG cloning plasmid |
CSB-CL615686HU2-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2220
- Sequence: ATGGGAATAAAGGTTCAACGTCCTCGATGTTTTTTTGACATTGCCATTAACAATCAACCTGCTGGAAGAGTTGTCTTTGAATTATTTTCTGATGTGTGCCCCAAAACATGCGAGAACTTTCGTTGTCTTTGTACAGGTGAAAAGGGGACCGGGAAATCAACTCAGAAACCATTAC
- Show more
|
Description: A cloning plasmid for the PPIG gene. |
Anti-PPIG (4F7) |
YF-MA16800 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPIG |
Anti-PPIG (4F8) |
YF-MA11167 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPIG |
Peptidylprolyl Isomerase G (PPIG) Antibody |
20-abx000715 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Peptidylprolyl Isomerase G (PPIG) Antibody |
abx431741-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Peptidylprolyl Isomerase G (PPIG) Antibody |
abx236677-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human Cyclophilin G (PPIG) Antibody |
30027-05111 |
AssayPro |
150 ug |
EUR 261 |
Rat PPIG shRNA Plasmid |
20-abx986822 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PPIG shRNA Plasmid |
20-abx956196 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PPIG shRNA Plasmid |
20-abx981607 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PPIG Recombinant Protein (Human) |
RP024277 |
ABM |
100 ug |
Ask for price |
PPIG Recombinant Protein (Human) |
RP042397 |
ABM |
100 ug |
Ask for price |
PPIG Recombinant Protein (Rat) |
RP221624 |
ABM |
100 ug |
Ask for price |
PPIG Recombinant Protein (Mouse) |
RP163739 |
ABM |
100 ug |
Ask for price |
Monoclonal PPIG Antibody (monoclonal) (M02), Clone: 4F8 |
AMM07281G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PPIG (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4F8. This antibody is applicable in WB, IHC and IF, E |
Human Cyclophilin G (PPIG) Antibody (Biotin Conjugate) |
30027-05121 |
AssayPro |
150 ug |
EUR 369 |
Phospho-PPIG (Ser376) Blocking Peptide |
AF4466-BP |
Affbiotech |
1mg |
EUR 195 |
PPIG ORF Vector (Human) (pORF) |
ORF008093 |
ABM |
1.0 ug DNA |
EUR 95 |
Ppig ORF Vector (Rat) (pORF) |
ORF073876 |
ABM |
1.0 ug DNA |
EUR 506 |
PPIG ORF Vector (Human) (pORF) |
ORF014133 |
ABM |
1.0 ug DNA |
EUR 354 |
Ppig ORF Vector (Mouse) (pORF) |
ORF054581 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Cyclophilin G (PPIG) AssayLite Antibody (FITC Conjugate) |
30027-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Cyclophilin G (PPIG) AssayLite Antibody (RPE Conjugate) |
30027-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Cyclophilin G (PPIG) AssayLite Antibody (APC Conjugate) |
30027-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Cyclophilin G (PPIG) AssayLite Antibody (PerCP Conjugate) |
30027-05171 |
AssayPro |
150 ug |
EUR 471 |
PPIG sgRNA CRISPR Lentivector set (Human) |
K1699101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ppig sgRNA CRISPR Lentivector set (Mouse) |
K4914901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ppig sgRNA CRISPR Lentivector set (Rat) |
K6975001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Cyclophilin G (PPIG) AssayMax ELISA Kit |
EP6520-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Peptidylprolyl Isomerase G (PPIG) ELISA Kit |
abx382392-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
PPIG sgRNA CRISPR Lentivector (Human) (Target 1) |
K1699102 |
ABM |
1.0 ug DNA |
EUR 154 |
PPIG sgRNA CRISPR Lentivector (Human) (Target 2) |
K1699103 |
ABM |
1.0 ug DNA |
EUR 154 |
PPIG sgRNA CRISPR Lentivector (Human) (Target 3) |
K1699104 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppig sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4914902 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppig sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4914903 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppig sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4914904 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppig sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6975002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppig sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6975003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppig sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6975004 |
ABM |
1.0 ug DNA |
EUR 154 |
PPIG Protein Vector (Human) (pPB-C-His) |
PV056529 |
ABM |
500 ng |
EUR 481 |
PPIG Protein Vector (Human) (pPB-N-His) |
PV056530 |
ABM |
500 ng |
EUR 481 |
PPIG Protein Vector (Human) (pPM-C-HA) |
PV056531 |
ABM |
500 ng |
EUR 481 |
PPIG Protein Vector (Human) (pPM-C-His) |
PV056532 |
ABM |
500 ng |
EUR 481 |
PPIG Protein Vector (Human) (pPB-C-His) |
PV032369 |
ABM |
500 ng |
EUR 329 |
PPIG Protein Vector (Human) (pPB-N-His) |
PV032370 |
ABM |
500 ng |
EUR 329 |
PPIG Protein Vector (Human) (pPM-C-HA) |
PV032371 |
ABM |
500 ng |
EUR 329 |
PPIG Protein Vector (Human) (pPM-C-His) |
PV032372 |
ABM |
500 ng |
EUR 329 |
PPIG Protein Vector (Mouse) (pPB-C-His) |
PV218322 |
ABM |
500 ng |
EUR 1065 |
PPIG Protein Vector (Mouse) (pPB-N-His) |
PV218323 |
ABM |
500 ng |
EUR 1065 |
PPIG Protein Vector (Mouse) (pPM-C-HA) |
PV218324 |
ABM |
500 ng |
EUR 1065 |
PPIG Protein Vector (Mouse) (pPM-C-His) |
PV218325 |
ABM |
500 ng |
EUR 1065 |
PPIG Protein Vector (Rat) (pPB-C-His) |
PV295502 |
ABM |
500 ng |
EUR 1166 |
PPIG Protein Vector (Rat) (pPB-N-His) |
PV295503 |
ABM |
500 ng |
EUR 1166 |
PPIG Protein Vector (Rat) (pPM-C-HA) |
PV295504 |
ABM |
500 ng |
EUR 1166 |
PPIG Protein Vector (Rat) (pPM-C-His) |
PV295505 |
ABM |
500 ng |
EUR 1166 |
Ppig 3'UTR GFP Stable Cell Line |
TU166776 |
ABM |
1.0 ml |
Ask for price |
PPIG 3'UTR Luciferase Stable Cell Line |
TU018588 |
ABM |
1.0 ml |
EUR 2333 |
Ppig 3'UTR Luciferase Stable Cell Line |
TU116776 |
ABM |
1.0 ml |
Ask for price |
PPIG 3'UTR GFP Stable Cell Line |
TU068588 |
ABM |
1.0 ml |
EUR 2333 |
Ppig 3'UTR GFP Stable Cell Line |
TU266624 |
ABM |
1.0 ml |
Ask for price |
Ppig 3'UTR Luciferase Stable Cell Line |
TU216624 |
ABM |
1.0 ml |
Ask for price |
PPIG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV672229 |
ABM |
1.0 ug DNA |
EUR 1355 |
PPIG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV672233 |
ABM |
1.0 ug DNA |
EUR 1355 |
PPIG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV672234 |
ABM |
1.0 ug DNA |
EUR 1355 |
PPIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV704175 |
ABM |
1.0 ug DNA |
EUR 450 |
PPIG Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV704179 |
ABM |
1.0 ug DNA |
EUR 450 |
PPIG Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV704180 |
ABM |
1.0 ug DNA |
EUR 450 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PPIG Rabbit Polyclonal Antibody