PSPC1 Polyclonal Antibody |
ABP60022-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PSPC1 protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of PSPC1 from Human. This PSPC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PSPC1 protein at amino acid sequence of 10-90 |
PSPC1 Polyclonal Antibody |
ES9973-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PSPC1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PSPC1 Polyclonal Antibody |
ES9973-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PSPC1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PSPC1 Rabbit pAb |
A9209-100ul |
Abclonal |
100 ul |
EUR 308 |
PSPC1 Rabbit pAb |
A9209-200ul |
Abclonal |
200 ul |
EUR 459 |
PSPC1 Rabbit pAb |
A9209-20ul |
Abclonal |
20 ul |
EUR 183 |
PSPC1 Rabbit pAb |
A9209-50ul |
Abclonal |
50 ul |
EUR 223 |
PSPC1 Antibody |
44675-100ul |
SAB |
100ul |
EUR 252 |
PSPC1 Antibody |
44675-50ul |
SAB |
50ul |
EUR 187 |
PSPC1 Antibody |
DF2220 |
Affbiotech |
200ul |
EUR 304 |
Description: PSPC1 antibody detects endogenous levels of total PSPC1. |
PSPC1 Antibody |
1-CSB-PA018937LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
PSPC1 Conjugated Antibody |
C44675 |
SAB |
100ul |
EUR 397 |
anti- PSPC1 antibody |
FNab06901 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: paraspeckle component 1
- Uniprot ID: Q8WXF1
- Gene ID: 55269
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against PSPC1 |
Anti-PSPC1 antibody |
STJ116347 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified. |
Anti-PSPC1 antibody |
STJ191131 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PSPC1 |
PSPC1 siRNA |
20-abx904331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PSPC1 siRNA |
20-abx930223 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PSPC1 siRNA |
20-abx930224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PSPC1 Antibody, HRP conjugated |
1-CSB-PA018937LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PSPC1 Antibody, FITC conjugated |
1-CSB-PA018937LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PSPC1 Antibody, Biotin conjugated |
1-CSB-PA018937LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PSPC1 Blocking Peptide |
DF2220-BP |
Affbiotech |
1mg |
EUR 195 |
PSPC1 cloning plasmid |
CSB-CL018937HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1182
- Sequence: atgatgttaagaggaaacctgaagcaagtgcgcattgagaaaaacccggcccgccttcgcgccctggagtccgcggtgggcgagagcgagccggcggccgcggcagccatggcgctcgctcttgccggggagccggcaccgcccgcgcccgcgcctccagaggaccacccggacg
- Show more
|
Description: A cloning plasmid for the PSPC1 gene. |
Paraspeckle Component 1 (PSPC1) Antibody |
20-abx217640 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Paraspeckle Component 1 (PSPC1) Antibody |
20-abx124686 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Paraspeckle Component 1 (PSPC1) Antibody |
abx122059-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Paraspeckle Component 1 (PSPC1) Antibody |
abx236901-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rat PSPC1 shRNA Plasmid |
20-abx989361 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PSPC1 shRNA Plasmid |
20-abx975719 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PSPC1 shRNA Plasmid |
20-abx960609 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PSPC1 Recombinant Protein (Human) |
RP025045 |
ABM |
100 ug |
Ask for price |
PSPC1 Recombinant Protein (Mouse) |
RP165395 |
ABM |
100 ug |
Ask for price |
PSPC1 Recombinant Protein (Rat) |
RP222725 |
ABM |
100 ug |
Ask for price |
Pspc1 ORF Vector (Rat) (pORF) |
ORF074243 |
ABM |
1.0 ug DNA |
EUR 506 |
PSPC1 ORF Vector (Human) (pORF) |
ORF008349 |
ABM |
1.0 ug DNA |
EUR 95 |
Pspc1 ORF Vector (Mouse) (pORF) |
ORF055133 |
ABM |
1.0 ug DNA |
EUR 506 |
PSPC1-OT1 Recombinant Protein (Human) |
RP085503 |
ABM |
100 ug |
Ask for price |
Pspc1 sgRNA CRISPR Lentivector set (Rat) |
K7459201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pspc1 sgRNA CRISPR Lentivector set (Mouse) |
K4813201 |
ABM |
3 x 1.0 ug |
EUR 339 |
PSPC1 sgRNA CRISPR Lentivector set (Human) |
K1746901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PSPC1-AS1 ORF Vector (Human) (pORF) |
ORF028501 |
ABM |
1.0 ug DNA |
Ask for price |
PSPC1-OT1 ORF Vector (Human) (pORF) |
ORF028502 |
ABM |
1.0 ug DNA |
Ask for price |
Chicken Paraspeckle component 1, PSPC1 ELISA KIT |
ELI-15492c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Paraspeckle component 1, Pspc1 ELISA KIT |
ELI-22155m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Paraspeckle component 1, PSPC1 ELISA KIT |
ELI-30610b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Paraspeckle component 1, PSPC1 ELISA KIT |
ELI-45456h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Paraspeckle Component 1 (PSPC1) ELISA Kit |
abx382541-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7459202 |
ABM |
1.0 ug DNA |
EUR 154 |
Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7459203 |
ABM |
1.0 ug DNA |
EUR 154 |
Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7459204 |
ABM |
1.0 ug DNA |
EUR 154 |
Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4813202 |
ABM |
1.0 ug DNA |
EUR 154 |
Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4813203 |
ABM |
1.0 ug DNA |
EUR 154 |
Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4813204 |
ABM |
1.0 ug DNA |
EUR 154 |
PSPC1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1746902 |
ABM |
1.0 ug DNA |
EUR 154 |
PSPC1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1746903 |
ABM |
1.0 ug DNA |
EUR 154 |
PSPC1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1746904 |
ABM |
1.0 ug DNA |
EUR 154 |
PSPC1 Protein Vector (Rat) (pPB-C-His) |
PV296970 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Rat) (pPB-N-His) |
PV296971 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Rat) (pPM-C-HA) |
PV296972 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Rat) (pPM-C-His) |
PV296973 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Human) (pPB-C-His) |
PV033393 |
ABM |
500 ng |
EUR 329 |
PSPC1 Protein Vector (Human) (pPB-N-His) |
PV033394 |
ABM |
500 ng |
EUR 329 |
PSPC1 Protein Vector (Human) (pPM-C-HA) |
PV033395 |
ABM |
500 ng |
EUR 329 |
PSPC1 Protein Vector (Human) (pPM-C-His) |
PV033396 |
ABM |
500 ng |
EUR 329 |
PSPC1 Protein Vector (Mouse) (pPB-C-His) |
PV220530 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Mouse) (pPB-N-His) |
PV220531 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Mouse) (pPM-C-HA) |
PV220532 |
ABM |
500 ng |
EUR 603 |
PSPC1 Protein Vector (Mouse) (pPM-C-His) |
PV220533 |
ABM |
500 ng |
EUR 603 |
Pspc1 3'UTR Luciferase Stable Cell Line |
TU117206 |
ABM |
1.0 ml |
Ask for price |
Pspc1 3'UTR GFP Stable Cell Line |
TU167206 |
ABM |
1.0 ml |
Ask for price |
Pspc1 3'UTR Luciferase Stable Cell Line |
TU216996 |
ABM |
1.0 ml |
Ask for price |
Pspc1 3'UTR GFP Stable Cell Line |
TU266996 |
ABM |
1.0 ml |
Ask for price |
PSPC1 3'UTR GFP Stable Cell Line |
TU069112 |
ABM |
1.0 ml |
EUR 1394 |
PSPC1 3'UTR Luciferase Stable Cell Line |
TU019112 |
ABM |
1.0 ml |
EUR 1394 |
PSPC1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV695761 |
ABM |
1.0 ug DNA |
EUR 682 |
PSPC1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV695765 |
ABM |
1.0 ug DNA |
EUR 682 |
PSPC1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV695766 |
ABM |
1.0 ug DNA |
EUR 682 |
PSPC1-OT1 Protein Vector (Human) (pPB-C-His) |
PV114006 |
ABM |
500 ng |
Ask for price |
PSPC1-OT1 Protein Vector (Human) (pPB-N-His) |
PV114007 |
ABM |
500 ng |
Ask for price |
PSPC1-OT1 Protein Vector (Human) (pPM-C-HA) |
PV114008 |
ABM |
500 ng |
Ask for price |
PSPC1-OT1 Protein Vector (Human) (pPM-C-His) |
PV114009 |
ABM |
500 ng |
Ask for price |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
PSPC1 Rabbit Polyclonal Antibody