PTPRB Rabbit Polyclonal Antibody

PTPRB Polyclonal Antibody

ABP60035-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRB from Human. This PTPRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360

PTPRB Polyclonal Antibody

ABP60035-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRB from Human. This PTPRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRB protein at amino acid sequence of 280-360

PTPRB Antibody

ABD9841 100 ug
EUR 438

PTPRB Antibody

46194-100ul 100ul
EUR 252

PTPRB Antibody

46194-50ul 50ul
EUR 187

PTPRB Antibody

DF9841 200ul
EUR 304
Description: PTPRB Antibody detects endogenous levels of total PTPRB.

PTPRB Antibody

1-CSB-PA019048ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRB. Recognizes PTPRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rabbit PTPRB ELISA Kit

ERTP0175 96Tests
EUR 521

Polyclonal PTPRB Antibody (internal region)

AMM07406G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTPRB (internal region). This antibody is tested and proven to work in the following applications:

PTPRB Conjugated Antibody

C46194 100ul
EUR 397

Anti-PTPRB antibody

STJ72286 100 µg
EUR 359

Anti-PTPRB antibody

STJ191297 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRB

PTPRB siRNA

20-abx930393
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRB siRNA

20-abx930394
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PTPRB

PVT18153 2 ug
EUR 258

PTPRB cloning plasmid

CSB-CL019048HU1-10ug 10ug
EUR 758
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2316
  • Sequence: atggaggctgaattttacatggtgattcttacctgcttgatcttcaggaactcagaagggtttcagattgtccatgtccagaaacaacagtgtcttttcaaaaatgagaaagtggtcgtgggctcatgcaacaggaccatccagaaccagcagtggatgtggactgaggatgaaa
  • Show more
Description: A cloning plasmid for the PTPRB gene.

PTPRB cloning plasmid

CSB-CL019048HU2-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5994
  • Sequence: ATGCTGAGCCATGGAGCCGGGTTGGCCTTGTGGATCACACTGAGCCTGCTGCAGACTGGACTGGCGGAGCCAGAGAGATGTAACTTCACCCTGGCGGAGTCCAAGGCCTCCAGCCATTCTGTGTCTATCCAGTGGAGAATTTTGGGCTCACCCTGTAACTTTAGCCTCATCTATA
  • Show more
Description: A cloning plasmid for the PTPRB gene.

PTPRB Blocking Peptide

DF9841-BP 1mg
EUR 195

pCR4-TOPO-PTPRB

PVT18197 2 ug
EUR 383

Protein tyrosine phosphatase receptor type B (PTPRB) polyclonal antibody

ABP-PAB-11037 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:

Human PTPRB ELISA Kit

EHP0175 96Tests
EUR 521

Goat PTPRB ELISA Kit

EGTP0175 96Tests
EUR 521

Bovine PTPRB ELISA Kit

EBP0175 96Tests
EUR 521

Anserini PTPRB ELISA Kit

EAP0175 96Tests
EUR 521

Canine PTPRB ELISA Kit

ECP0175 96Tests
EUR 521

Human PTPRB ELISA KIT

ELI-16748h 96 Tests
EUR 824

Porcine PTPRB ELISA Kit

EPP0175 96Tests
EUR 521

Rat PTPRB ELISA Kit

ERP0175 96Tests
EUR 521

Mouse Ptprb ELISA KIT

ELI-35907m 96 Tests
EUR 865

Mouse PTPRB ELISA Kit

EMP0175 96Tests
EUR 521

Human PTPRB shRNA Plasmid

20-abx953909
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PTPRB shRNA Plasmid

20-abx972300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human)

4-PAB048Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse)

4-PAB048Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat)

4-PAB048Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), APC

4-PAB048Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Biotinylated

4-PAB048Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Cy3

4-PAB048Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), FITC

4-PAB048Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), HRP

4-PAB048Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), PE

4-PAB048Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), APC

4-PAB048Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

PTPRB Rabbit Polyclonal Antibody