Biocat Net

Amine biocat 3.0

PTPRB Rabbit Polyclonal Antibody

PTPRB Polyclonal Antibody

ES10139-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRB Polyclonal Antibody

ES10139-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRB Antibody

46194-100ul 100ul
EUR 252

PTPRB Antibody

46194-50ul 50ul
EUR 187

PTPRB Antibody

DF9841 200ul
EUR 304
Description: PTPRB Antibody detects endogenous levels of total PTPRB.

PTPRB Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRB. Recognizes PTPRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTPRB Antibody

ABD9841 100 ug
EUR 438


ERTP0175 96Tests
EUR 521

Polyclonal PTPRB Antibody (internal region)

AMM07406G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTPRB (internal region). This antibody is tested and proven to work in the following applications:

PTPRB Conjugated Antibody

C46194 100ul
EUR 397

Anti-PTPRB antibody

STJ72286 100 µg
EUR 359

Anti-PTPRB antibody

STJ191297 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18153 2 ug
EUR 258

PTPRB Blocking Peptide

DF9841-BP 1mg
EUR 195

PTPRB cloning plasmid

CSB-CL019048HU1-10ug 10ug
EUR 758
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2316
  • Sequence: atggaggctgaattttacatggtgattcttacctgcttgatcttcaggaactcagaagggtttcagattgtccatgtccagaaacaacagtgtcttttcaaaaatgagaaagtggtcgtgggctcatgcaacaggaccatccagaaccagcagtggatgtggactgaggatgaaa
  • Show more
Description: A cloning plasmid for the PTPRB gene.

PTPRB cloning plasmid

CSB-CL019048HU2-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5994
  • Show more
Description: A cloning plasmid for the PTPRB gene.


PVT18197 2 ug
EUR 383

Protein tyrosine phosphatase receptor type B (PTPRB) polyclonal antibody

ABP-PAB-11037 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:


EHP0175 96Tests
EUR 521


EBP0175 96Tests
EUR 521

Anserini PTPRB ELISA Kit

EAP0175 96Tests
EUR 521


ECP0175 96Tests
EUR 521


EGTP0175 96Tests
EUR 521


ELI-16748h 96 Tests
EUR 824

Mouse PTPRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EPP0175 96Tests
EUR 521


ERP0175 96Tests
EUR 521


EMP0175 96Tests
EUR 521

Mouse Ptprb ELISA KIT

ELI-35907m 96 Tests
EUR 865

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Asn1041~Tyr1310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protein Tyrosine Phosphatase Receptor Type B (PTPRB)

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Ala1655~Asp1918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with PE.

Protein Tyrosine Phosphatase Receptor Type B (PTPRB) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRB (Gly1214~Val1463)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Protein Tyrosine Phosphatase Receptor Type B (PTPRB). This antibody is labeled with APC.

PTPRB Rabbit Polyclonal Antibody