PTPRD Polyclonal Antibody |
ABP60036-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
- Applications tips:
|
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590 |
PTPRD Polyclonal Antibody |
ABP60036-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
- Applications tips:
|
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590 |
PTPRD Polyclonal Antibody |
28823-100ul |
SAB |
100ul |
EUR 252 |
PTPRD Polyclonal Antibody |
28823-50ul |
SAB |
50ul |
EUR 187 |
PTPRD Polyclonal Antibody |
29396-100ul |
SAB |
100ul |
EUR 252 |
PTPRD Polyclonal Antibody |
29396-50ul |
SAB |
50ul |
EUR 187 |
PTPRD Polyclonal Antibody |
31600-100ul |
SAB |
100ul |
EUR 252 |
PTPRD Polyclonal Antibody |
31600-50ul |
SAB |
50ul |
EUR 187 |
PTPRD Rabbit pAb |
A15713-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRD Rabbit pAb |
A15713-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRD Rabbit pAb |
A15713-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRD Rabbit pAb |
A15713-50ul |
Abclonal |
50 ul |
EUR 223 |
PTPRD Rabbit pAb |
A15089-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRD Rabbit pAb |
A15089-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRD Rabbit pAb |
A15089-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRD Rabbit pAb |
A15089-50ul |
Abclonal |
50 ul |
EUR 223 |
PTPRD Rabbit pAb |
A8559-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRD Rabbit pAb |
A8559-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRD Rabbit pAb |
A8559-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRD Rabbit pAb |
A8559-50ul |
Abclonal |
50 ul |
EUR 223 |
PTPRD Polyclonal Conjugated Antibody |
C29396 |
SAB |
100ul |
EUR 397 |
PTPRD Polyclonal Conjugated Antibody |
C31600 |
SAB |
100ul |
EUR 397 |
PTPRD Polyclonal Conjugated Antibody |
C28823 |
SAB |
100ul |
EUR 397 |
PTPRD Antibody |
25495-100ul |
SAB |
100ul |
EUR 390 |
Anti-PTPRD antibody |
STJ111295 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. |
Anti-PTPRD antibody |
STJ117283 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. |
Anti-PTPRD antibody |
STJ191298 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PTPRD |
PTPRD siRNA |
20-abx930399 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRD siRNA |
20-abx930400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRD cloning plasmid |
CSB-CL019051HU-10ug |
Cusabio |
10ug |
EUR 1918 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4521
- Sequence: ATGGTGCACGTAGCCAGGCTGCTGCTGCTGCTCCTCACTTTCTTCCTCCGCACGGATGCTGAGACACCTCCAAGGTTTACACGAACACCCGTTGATCAGACAGGGGTCTCTGGCGGAGTTGCCTCTTTCATCTGCCAAGCTACGGGAGACCCAAGACCTAAAATTGTCTGGAACA
- Show more
|
Description: A cloning plasmid for the PTPRD gene. |
Protein tyrosine phosphatase receptor type D (PTPRD) polyclonal antibody |
ABP-PAB-11040 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Phosphatases
- Brand:
|
Human PTPRD shRNA Plasmid |
20-abx953911 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PTPRD shRNA Plasmid |
20-abx972302 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CellExp? PTPRD, Human Recombinant |
P1184-10 |
Biovision |
|
EUR 153 |
Human CellExp? PTPRD, Human Recombinant |
P1184-50 |
Biovision |
|
EUR 512 |
PTPRD ORF Vector (Human) (pORF) |
ORF014206 |
ABM |
1.0 ug DNA |
EUR 354 |
Ptprd ORF Vector (Mouse) (pORF) |
ORF055240 |
ABM |
1.0 ug DNA |
EUR 1572 |
Ptprd ORF Vector (Mouse) (pORF) |
ORF055241 |
ABM |
1.0 ug DNA |
EUR 506 |
Receptor-Type Tyrosine-Protein Phosphatase Delta (PTPRD) Antibody |
20-abx124253 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
PTPRD sgRNA CRISPR Lentivector set (Human) |
K1757701 |
ABM |
3 x 1.0 ug |
EUR 339 |
PTPRD Rabbit Polyclonal Antibody