PTPRD Rabbit Polyclonal Antibody

PTPRD Polyclonal Antibody

ABP60036-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590

PTPRD Polyclonal Antibody

ABP60036-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRD from Human, Mouse. This PTPRD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRD protein at amino acid sequence of 510-590

PTPRD Polyclonal Antibody

28823-100ul 100ul
EUR 252

PTPRD Polyclonal Antibody

28823-50ul 50ul
EUR 187

PTPRD Polyclonal Antibody

29396-100ul 100ul
EUR 252

PTPRD Polyclonal Antibody

29396-50ul 50ul
EUR 187

PTPRD Polyclonal Antibody

31600-100ul 100ul
EUR 252

PTPRD Polyclonal Antibody

31600-50ul 50ul
EUR 187

PTPRD Rabbit pAb

A15713-100ul 100 ul
EUR 308

PTPRD Rabbit pAb

A15713-200ul 200 ul
EUR 459

PTPRD Rabbit pAb

A15713-20ul 20 ul
EUR 183

PTPRD Rabbit pAb

A15713-50ul 50 ul
EUR 223

PTPRD Rabbit pAb

A15089-100ul 100 ul
EUR 308

PTPRD Rabbit pAb

A15089-200ul 200 ul
EUR 459

PTPRD Rabbit pAb

A15089-20ul 20 ul
EUR 183

PTPRD Rabbit pAb

A15089-50ul 50 ul
EUR 223

PTPRD Rabbit pAb

A8559-100ul 100 ul
EUR 308

PTPRD Rabbit pAb

A8559-200ul 200 ul
EUR 459

PTPRD Rabbit pAb

A8559-20ul 20 ul
EUR 183

PTPRD Rabbit pAb

A8559-50ul 50 ul
EUR 223

PTPRD Polyclonal Conjugated Antibody

C29396 100ul
EUR 397

PTPRD Polyclonal Conjugated Antibody

C31600 100ul
EUR 397

PTPRD Polyclonal Conjugated Antibody

C28823 100ul
EUR 397

PTPRD Antibody

25495-100ul 100ul
EUR 390

Anti-PTPRD antibody

STJ111295 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5.

Anti-PTPRD antibody

STJ117283 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5.

Anti-PTPRD antibody

STJ118173 100 µl
EUR 277

Anti-PTPRD antibody

STJ191298 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRD

PTPRD siRNA

20-abx930399
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRD siRNA

20-abx930400
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRD cloning plasmid

CSB-CL019051HU-10ug 10ug
EUR 1918
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4521
  • Sequence: ATGGTGCACGTAGCCAGGCTGCTGCTGCTGCTCCTCACTTTCTTCCTCCGCACGGATGCTGAGACACCTCCAAGGTTTACACGAACACCCGTTGATCAGACAGGGGTCTCTGGCGGAGTTGCCTCTTTCATCTGCCAAGCTACGGGAGACCCAAGACCTAAAATTGTCTGGAACA
  • Show more
Description: A cloning plasmid for the PTPRD gene.

Protein tyrosine phosphatase receptor type D (PTPRD) polyclonal antibody

ABP-PAB-11040 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:

Mouse Ptprd ELISA KIT

ELI-43092m 96 Tests
EUR 865

Human PTPRD ELISA KIT

ELI-30528h 96 Tests
EUR 824

Human PTPRD shRNA Plasmid

20-abx953911
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PTPRD shRNA Plasmid

20-abx972302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CellExp? PTPRD, Human Recombinant

P1184-10
EUR 153

Human CellExp? PTPRD, Human Recombinant

P1184-50
EUR 512

PTPRD ORF Vector (Human) (pORF)

ORF014206 1.0 ug DNA
EUR 354

Ptprd ORF Vector (Mouse) (pORF)

ORF055240 1.0 ug DNA
EUR 1572

Ptprd ORF Vector (Mouse) (pORF)

ORF055241 1.0 ug DNA
EUR 506

Receptor-Type Tyrosine-Protein Phosphatase Delta (PTPRD) Antibody

20-abx124253
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PTPRD sgRNA CRISPR Lentivector set (Human)

K1757701 3 x 1.0 ug
EUR 339

PTPRD Rabbit Polyclonal Antibody