Biocat Net

Amine biocat 3.0

PTPRE Rabbit Polyclonal Antibody

PTPRE Rabbit pAb

A4063-100ul 100 ul
EUR 308

PTPRE Rabbit pAb

A4063-200ul 200 ul
EUR 459

PTPRE Rabbit pAb

A4063-20ul 20 ul Ask for price

PTPRE Rabbit pAb

A4063-50ul 50 ul Ask for price

PTPRE Rabbit pAb

A7209-100ul 100 ul
EUR 308

PTPRE Rabbit pAb

A7209-200ul 200 ul
EUR 459

PTPRE Rabbit pAb

A7209-20ul 20 ul
EUR 183

PTPRE Rabbit pAb

A7209-50ul 50 ul
EUR 223

PTPRE antibody

70R-19648 50 ul
EUR 435
Description: Rabbit polyclonal PTPRE antibody

PTPRE Antibody

35900-100ul 100ul
EUR 252

PTPRE antibody

10R-5516 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5518 100 ul
EUR 726
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5519 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5521 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5522 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5526 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5527 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE antibody

10R-5528 100 ul
EUR 691
Description: Mouse monoclonal PTPRE antibody

PTPRE Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50

PTPRE Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50

PTPRE antibody

70R-7313 50 ug
EUR 467
Description: Rabbit polyclonal PTPRE antibody raised against the middle region of PTPRE

PTPRE Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PTPRE Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PTPRE. Recognizes PTPRE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal PTPRE Antibody (N-term)

AMM07408G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTPRE (N-term). This antibody is tested and proven to work in the following applications:

Ptpre/ Rat Ptpre ELISA Kit

ELI-36784r 96 Tests
EUR 886

PTPRE Conjugated Antibody

C35900 100ul
EUR 397

anti- PTPRE antibody

FNab06944 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: protein tyrosine phosphatase, receptor type, E
  • Uniprot ID: P23469
  • Gene ID: 5791
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PTPRE

Anti-PTPRE antibody

PAab06944 100 ug
EUR 412

Anti-PTPRE antibody

STJ111210 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels.

Anti-PTPRE antibody

STJ29289 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels.

Anti-PTPRE antibody

STJ191299 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRE


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRE Blocking Peptide

33R-9603 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PTPRE antibody, catalog no. 70R-7313

PTPRE cloning plasmid

CSB-CL019052HU-10ug 10ug
EUR 699
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2103
  • Sequence: atggagcccttgtgtccactcctgctggtgggttttagcttgccgctcgccagggctctcaggggcaacgagaccactgccgacagcaacgagacaaccacgacctcaggccctccggacccgggcgcctcccagccgctgctggcctggctgctactgccgctgctgctcctcc
  • Show more
Description: A cloning plasmid for the PTPRE gene.

Protein tyrosine phosphatase receptor type E (PTPRE) polyclonal antibody

ABP-PAB-11041 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:


ELI-15704h 96 Tests
EUR 824


EF002180 96 Tests
EUR 689

Mouse Ptpre ELISA KIT

ELI-45475m 96 Tests
EUR 865

Mouse PTPRE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTPRE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTPRE Recombinant Protein (Human)

RP025225 100 ug Ask for price

PTPRE Rabbit Polyclonal Antibody