PTPRS Polyclonal Antibody |
ES10143-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PTPRS from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTPRS Polyclonal Antibody |
ES10143-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PTPRS from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTPRS Rabbit pAb |
A8866-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRS Rabbit pAb |
A8866-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRS Rabbit pAb |
A8866-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRS Rabbit pAb |
A8866-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit |
DLR-PTPRS-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit |
DLR-PTPRS-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit |
RDR-PTPRS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit |
RDR-PTPRS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit |
RD-PTPRS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit |
RD-PTPRS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
PTPRS antibody |
70R-19653 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PTPRS antibody |
PTPRS Antibody |
47432-100ul |
SAB |
100ul |
EUR 252 |
PTPRS Antibody |
1-CSB-PA613393LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PTPRS Antibody |
DF12714 |
Affbiotech |
200ul |
EUR 304 |
Description: PTPRS Antibody detects endogenous levels of PTPRS. |
PTPRS Antibody |
1-CSB-PA019064GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP, FC |
PTPRS Conjugated Antibody |
C47432 |
SAB |
100ul |
EUR 397 |
anti- PTPRS antibody |
FNab06948 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: protein tyrosine phosphatase, receptor type, S
- Uniprot ID: Q13332
- Gene ID: 5802
- Research Area: Signal Transduction, Metabolism, Immunology, Developmental biology, Ne
- Show more
|
Description: Antibody raised against PTPRS |
Anti-PTPRS antibody |
STJ113592 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. |
Anti-PTPRS antibody |
STJ191301 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PTPRS |
PTPRS siRNA |
20-abx904379 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRS siRNA |
20-abx930424 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRS siRNA |
20-abx930425 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRS Antibody, HRP conjugated |
1-CSB-PA613393LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PTPRS Antibody, FITC conjugated |
1-CSB-PA613393LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PTPRS Antibody, Biotin conjugated |
1-CSB-PA613393LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PTPRS Blocking Peptide |
DF12714-BP |
Affbiotech |
1mg |
EUR 195 |
PTPRS cloning plasmid |
CSB-CL613393HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atggcgcccacctggggccctggcatggtgtctgtggttggtcccatgggcctccttgtggtcctgctcgttggaggctgtgcagcagaagagccccccaggtttatcaaagaacccaaggaccagatcggcgtgtcggggggtgtggcctctttcgtgtgtcaggccacgggtga
- Show more
|
Description: A cloning plasmid for the PTPRS gene. |
Anti-PTPRS (1H6) |
YF-MA15061 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PTPRS |
Protein tyrosine phosphatase receptor-type S (PTPRS) polyclonal antibody |
ABP-PAB-11050 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Phosphatases
- Brand:
|
Mouse PTPRS shRNA Plasmid |
20-abx972313 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat PTPRS shRNA Plasmid |
20-abx985097 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PTPRS shRNA Plasmid |
20-abx953924 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human) |
4-PAB295Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) |
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), APC |
4-PAB295Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with APC. |
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), Biotinylated |
4-PAB295Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with Biotin. |
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), Cy3 |
4-PAB295Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with Cy3. |
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), FITC |
4-PAB295Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with FITC. |
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), HRP |
4-PAB295Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with HRP. |
Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), PE |
4-PAB295Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRS (Arg77~Gly361)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with PE. |
PTPRS Rabbit Polyclonal Antibody