PTPRS Rabbit Polyclonal Antibody

PTPRS Polyclonal Antibody

ES10143-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRS from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRS Polyclonal Antibody

ES10143-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRS from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRS Rabbit pAb

A8866-100ul 100 ul
EUR 308

PTPRS Rabbit pAb

A8866-200ul 200 ul
EUR 459

PTPRS Rabbit pAb

A8866-20ul 20 ul
EUR 183

PTPRS Rabbit pAb

A8866-50ul 50 ul
EUR 223

Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit

EUR 498
  • Should the Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit

EUR 647
  • Should the Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit

RDR-PTPRS-Hu-48Tests 48 Tests
EUR 522

Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit

RDR-PTPRS-Hu-96Tests 96 Tests
EUR 724

Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit

RD-PTPRS-Hu-48Tests 48 Tests
EUR 500

Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS) ELISA Kit

RD-PTPRS-Hu-96Tests 96 Tests
EUR 692

PTPRS antibody

70R-19653 50 ul
EUR 435
Description: Rabbit polyclonal PTPRS antibody

PTPRS Antibody

47432-100ul 100ul
EUR 252

PTPRS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTPRS Antibody

DF12714 200ul
EUR 304
Description: PTPRS Antibody detects endogenous levels of PTPRS.

PTPRS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP, FC

PTPRS Conjugated Antibody

C47432 100ul
EUR 397

anti- PTPRS antibody

FNab06948 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: protein tyrosine phosphatase, receptor type, S
  • Uniprot ID: Q13332
  • Gene ID: 5802
  • Research Area: Signal Transduction, Metabolism, Immunology, Developmental biology, Ne
  • Show more
Description: Antibody raised against PTPRS

Anti-PTPRS antibody

PAab06948 100 ug
EUR 355

Anti-PTPRS antibody

STJ113592 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported.

Anti-PTPRS antibody

STJ191301 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRS

Ptprs/ Rat Ptprs ELISA Kit

ELI-35912r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTPRS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTPRS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRS. Recognizes PTPRS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PTPRS Blocking Peptide

DF12714-BP 1mg
EUR 195

PTPRS cloning plasmid

CSB-CL613393HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atggcgcccacctggggccctggcatggtgtctgtggttggtcccatgggcctccttgtggtcctgctcgttggaggctgtgcagcagaagagccccccaggtttatcaaagaacccaaggaccagatcggcgtgtcggggggtgtggcctctttcgtgtgtcaggccacgggtga
  • Show more
Description: A cloning plasmid for the PTPRS gene.

Anti-PTPRS (1H6)

YF-MA15061 100 ug
EUR 363
Description: Mouse monoclonal to PTPRS

Protein tyrosine phosphatase receptor-type S (PTPRS) polyclonal antibody

ABP-PAB-11050 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:


ELI-30495h 96 Tests
EUR 824

Mouse Ptprs ELISA KIT

ELI-30496m 96 Tests
EUR 865


EF002183 96 Tests
EUR 689

Mouse PTPRS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTPRS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS)

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRS (Arg77~Gly361)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type S (PTPRS). This antibody is labeled with PE.

PTPRS Rabbit Polyclonal Antibody