RAB1A Rabbit Polyclonal Antibody

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RD-RAB1A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

RAB1A Polyclonal Antibody
28668-100ul	SAB	100ul	EUR 252

RAB1A Polyclonal Antibody
28668-50ul	SAB	50ul	EUR 187

RAB1A Polyclonal Antibody
30025-100ul	SAB	100ul	EUR 252

RAB1A Polyclonal Antibody
30025-50ul	SAB	50ul	EUR 187

RAB1A Polyclonal Antibody
A52624	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RAB1A Polyclonal Antibody
ABP60061-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130

RAB1A Polyclonal Antibody
ABP60061-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130

RAB1A Polyclonal Antibody
ABP60061-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130

RAB1A Polyclonal Antibody
ES10115-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB1A Polyclonal Antibody
ES10115-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB1A Rabbit pAb
A14663-100ul	Abclonal	100 ul	EUR 308

RAB1A Rabbit pAb
A14663-200ul	Abclonal	200 ul	EUR 459

RAB1A Rabbit pAb
A14663-20ul	Abclonal	20 ul	EUR 183

RAB1A Rabbit pAb
A14663-50ul	Abclonal	50 ul	EUR 223

RAB1A Rabbit pAb
A17364-100ul	Abclonal	100 ul	EUR 308

RAB1A Rabbit pAb
A17364-200ul	Abclonal	200 ul	EUR 459

RAB1A Rabbit pAb
A17364-20ul	Abclonal	20 ul	EUR 183

RAB1A Rabbit pAb
A17364-50ul	Abclonal	50 ul	EUR 223

RAB1A Polyclonal Conjugated Antibody
C28668	SAB	100ul	EUR 397

RAB1A Polyclonal Conjugated Antibody
C30025	SAB	100ul	EUR 397

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human)
4-PAJ783Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A)

RAB1A antibody
70R-19689	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAB1A antibody

RAB1A antibody
70R-2860	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAB1A antibody raised against the middle region of RAB1A

Rab1A antibody
70R-15148	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Rab1A antibody

RAB1A Antibody
39737-100ul	SAB	100ul	EUR 390

RAB1A Antibody
1-CSB-PA00335A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RAB1A Antibody
DF9817	Affbiotech	200ul	EUR 304
Description: RAB1A Antibody detects endogenous levels of total RAB1A.

RAB1A Antibody
1-CSB-PA019167GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB1A Antibody
ABD9817	Lifescience Market	100 ug	EUR 438

Polyclonal RAB1A Antibody (C-Terminus)
AMM07451G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RAB1A (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal RAB1A antibody - middle region
AMM07452G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB1A - middle region. This antibody is tested and proven to work in the following applications:

RAB1A Polyclonal Antibody, Biotin Conjugated
A52621	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RAB1A Polyclonal Antibody, FITC Conjugated
A52622	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RAB1A Polyclonal Antibody, HRP Conjugated
A52623	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC
4-PAJ783Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Biotinylated
4-PAJ783Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Biotin.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Cy3
4-PAJ783Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Cy3.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), FITC
4-PAJ783Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with FITC.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), HRP
4-PAJ783Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with HRP.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), PE
4-PAJ783Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with PE.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC-Cy7
4-PAJ783Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC-Cy7.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx218111-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx036061-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
20-abx131530	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
20-abx174325	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx237000-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Rab1A antibody (HRP)
60R-1281	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Rab1A antibody (HRP)

Rab1A antibody (FITC)
60R-1282	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Rab1A antibody (FITC)

Rab1A antibody (biotin)
60R-1283	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Rab1A antibody (biotin)

anti- RAB1A antibody
FNab07000	FN Test	100µg	EUR 505.25
Immunogen: RAB1A, member RAS oncogene family Uniprot ID: P62820 Gene ID: 5861 Research Area: Signal Transduction
Description: Antibody raised against RAB1A

Anti-RAB1A antibody
PAab07000	Lifescience Market	100 ug	EUR 355

Anti-RAB1A antibody
STJ116867	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.

Anti-RAB1A antibody
STJ119490	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.

Anti-RAB1A antibody
STJ191273	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RAB1A

Rab1A/ Rat Rab1A ELISA Kit
ELI-30459r	Lifescience Market	96 Tests	EUR 886

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody Pair
abx117425-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

RAB1A siRNA
20-abx904415	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1A siRNA
20-abx930611	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1A siRNA
20-abx930612	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1A Antibody, HRP conjugated
1-CSB-PA00335B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB1A Antibody, FITC conjugated
1-CSB-PA00335C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB1A Antibody, Biotin conjugated
1-CSB-PA00335D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant RAB1A, Member RAS Oncogene Family (RAB1A)
4-RPJ783Hu01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P62820 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.2kDa Isoelectric Point: Inquire
Description: Recombinant Human RAB1A, Member RAS Oncogene Family expressed in: E.coli

Human RAB1A, Member RAS Oncogene Family (RAB1A) Protein
20-abx650772	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RAB1A Blocking Peptide
33R-1303	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE3A antibody, catalog no. 70R-5247

RAB1A Blocking Peptide
DF9817-BP	Affbiotech	1mg	EUR 195

RAB1A cloning plasmid
CSB-CL019167HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 618 Sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaac Show more
Description: A cloning plasmid for the RAB1A gene.

pENTR223-RAB1A vector
PVT11896	Lifescience Market	2 ug	EUR 304

pCMV-SPORT6-RAB1A
PVT18186	Lifescience Market	2 ug	EUR 231

Anti-Rab1A (3F10)
YF-MA15077	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Rab1A

Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit
20-abx190393	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
20-abx152910	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
20-abx258120	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit
20-abx495781	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit
4-SCJ783Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB1A, Member RAS Oncogene Family Clia kit. Alternative names of the recognized antigen: RAB1 YPT1 Ras-related protein Rab-1A YPT1-related protein
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A)Tissue homogenates and other biological fluids

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
4-SEJ783Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1 YPT1 Ras-related protein Rab-1A YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
4-SEJ783Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1 YPT1 Ras-related protein Rab-1A YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB1A (RAB1A, Member RAS Oncogene Family)
ELK4405	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat RAB1A (RAB1A, Member RAS Oncogene Family)
ELK7514	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rab1A, Member Ras Oncogene Family Antibody
20-abx114967	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RAB1A protein (His tag)
80R-1658	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human RAB1A protein

RAB1A ELISA KIT|Human
EF002218	Lifescience Market	96 Tests	EUR 689

Mouse RAB1A shRNA Plasmid
20-abx972333	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RAB1A shRNA Plasmid
20-abx986688	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAB1A shRNA Plasmid
20-abx953951	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine RAB1A ELISA KIT
ELI-36012d	Lifescience Market	96 Tests	EUR 928

RAB1A Recombinant Protein (Human)
RP025432	ABM	100 ug	Ask for price

Ras-Related Protein Rab-1A (RAB1A) Antibody
20-abx110166	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB1A ORF Vector (Human) (pORF)
ORF008478	ABM	1.0 ug DNA	EUR 95

RAB1A ELISA Kit (Human) (OKCD00582)
OKCD00582	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.14"Rab1 small GTP-binding protein regulates cell surface trafficking of the human calcium-sensing receptor."_x005F_x005F_x000D_Zhuang X., Adipietro K.A., Datta S., Northup J.K., Ray K._x005F_x005F_x000D_Endocrinology 151:5114-5123(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, MUTAGENESIS OF ASN-124.Ref.15"Regulation of integrin beta 1 recycling to lipid rafts by Rab1a to promote cell migration."_x005F_x005F_x000D_Wang C., Yoo Y., Fan H., Kim E., Guan K.L., Guan J.L._x005F_x005F_x000D_J. Biol. Chem. 285:29398-29405(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.17"Proteomic analysis of endocytic vesicles: Rab1a regulates motility of early endocytic vesicles."_x005F_x005F_x000D_Mukhopadhyay A., Nieves E., Che F.Y., Wang J., Jin L., Murray J.W., Gordon K., Angeletti R.H., Wolkoff A.W._x005F_x005F_x000D_J. Cell Sci. 124:765-775(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.27"Structurally distinct bacterial TBC-like GAPs link Arf GTPase to Rab1 inactivation to counteract host defenses."_x005F_x005F_x000D_Dong N., Zhu Y., Lu Q., Hu L., Zheng Y., Shao F._x005F_x005F_x000D_Cell 150:1029-1041(2012) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.80 ANGSTROMS) OF 6-176 IN COMPLEXES WITH GDP; ARF6; E.COLI ESPG AND S.FLEXNERI VIRA, FUNCTION, SUBCELLULAR LOCATION, IDENTIFICATION IN A COMPLEX WITH ARF6 AND E.COLI ESPG, INTERACTION WITH E.COLI ESPG AND S.FLEXNERI VIRA. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.067 ng/mL

Rab1A ELISA Kit (Rat) (OKCD02017)
OKCD02017	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in anterograde melanosome transport. Plays a role in microtubule-dependent protein transport by early endosomes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

RAB1A ELISA Kit (Mouse) (OKCA01761)
OKCA01761	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.9 pg/mL

RAB1A ELISA Kit (Human) (OKDD00496)
OKDD00496	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.067 ng/mL

RAB1A, Member RAS Oncogene Family Protein
20-abx262476	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

RAB1A sgRNA CRISPR Lentivector set (Human)
K1767901	ABM	3 x 1.0 ug	EUR 339

Recombinant Human RAB1A, Member RAS Oncogene Family
7-05971	CHI Scientific	2µg	Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family
7-05972	CHI Scientific	10µg	Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family
7-05973	CHI Scientific	1mg	Ask for price

Human Ras-related protein Rab-1A (RAB1A)
1-CSB-RP003344h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 49.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-1A(RAB1A) expressed in E.coli

RAB1A sgRNA CRISPR Lentivector (Human) (Target 1)
K1767902	ABM	1.0 ug DNA	EUR 154

RAB1A sgRNA CRISPR Lentivector (Human) (Target 2)
K1767903	ABM	1.0 ug DNA	EUR 154

RAB1A sgRNA CRISPR Lentivector (Human) (Target 3)
K1767904	ABM	1.0 ug DNA	EUR 154

RAB1A Protein Vector (Human) (pPB-C-His)
PV033909	ABM	500 ng	EUR 329

RAB1A Protein Vector (Human) (pPB-N-His)
PV033910	ABM	500 ng	EUR 329

RAB1A Protein Vector (Human) (pPM-C-HA)
PV033911	ABM	500 ng	EUR 329

RAB1A Protein Vector (Human) (pPM-C-His)
PV033912	ABM	500 ng	EUR 329

RAB1A 3'UTR GFP Stable Cell Line
TU069324	ABM	1.0 ml	EUR 1521

RAB1A 3'UTR Luciferase Stable Cell Line
TU019324	ABM	1.0 ml	EUR 1521

RAB1A Chemi-Luminescent ELISA Kit (Human) (OKCD03893)
OKCD03893	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

RAB1A, Member RAS Oncogene Family Recombinant Protein Human
PROTP62820	BosterBio	Regular: 10ug	EUR 317
Description: RAB1A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 225 amino acids (1-205.a.a) and having a molecular mass of 24.8kDa. ;RAB1A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

WIPI2 Rabbit Polyclonal Antibody
ABP57587-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

FAK Rabbit Polyclonal Antibody
ABP57588-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

Gab1 Rabbit Polyclonal Antibody
ABP57589-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

ERK1 Rabbit Polyclonal Antibody
ABP57590-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RAB1A Rabbit Polyclonal Antibody