RAB30 Polyclonal Antibody |
ABP60065-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 |
RAB30 Polyclonal Antibody |
ABP60065-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 |
RAB30 Polyclonal Antibody |
A50889 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RAB30 antibody |
70R-50949 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RAB30 antibody |
RAB30 Antibody |
46182-100ul |
SAB |
100ul |
EUR 252 |
RAB30 Antibody |
46182-50ul |
SAB |
50ul |
EUR 187 |
RAB30 Antibody |
DF9824 |
Affbiotech |
200ul |
EUR 304 |
Description: RAB30 Antibody detects endogenous levels of total RAB30. |
RAB30 Antibody |
1-CSB-PA613602LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified |
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RAB30 Polyclonal Antibody, HRP Conjugated |
A50890 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RAB30 Polyclonal Antibody, FITC Conjugated |
A50891 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
RAB30 Polyclonal Antibody, Biotin Conjugated |
A50892 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Polyclonal RAB30 Antibody - C-terminal region |
AMM07464G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB30 - C-terminal region. This antibody is tested and proven to work in the following applications: |
RAB30 Conjugated Antibody |
C46182 |
SAB |
100ul |
EUR 397 |
RAB30 Antibody (HRP) |
20-abx306784 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RAB30 Antibody (FITC) |
20-abx306785 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RAB30 Antibody (Biotin) |
20-abx306786 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-RAB30 antibody |
STJ191279 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RAB30 |
RAB30 siRNA |
20-abx930638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB30 siRNA |
20-abx930639 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB30 Antibody, HRP conjugated |
1-CSB-PA613602LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified |
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RAB30 Antibody, FITC conjugated |
1-CSB-PA613602LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RAB30 Antibody, Biotin conjugated |
1-CSB-PA613602LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RAB30 cloning plasmid |
CSB-CL613602HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 612
- Sequence: atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaa
- Show more
|
Description: A cloning plasmid for the RAB30 gene. |
RAB30 Rabbit Polyclonal Antibody