RAB30 Rabbit Polyclonal Antibody

RAB30 Polyclonal Antibody

ABP60065-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody

ABP60065-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody

A50889 100 µg
EUR 570.55
Description: The best epigenetics products

RAB30 Antibody

ABD9824 100 ug
EUR 438

RAB30 antibody

70R-50949 100 ul
EUR 244
Description: Purified Polyclonal RAB30 antibody

RAB30 Antibody

46182-100ul 100ul
EUR 252

RAB30 Antibody

46182-50ul 50ul
EUR 187

RAB30 Antibody

DF9824 200ul
EUR 304
Description: RAB30 Antibody detects endogenous levels of total RAB30.

RAB30 Antibody

1-CSB-PA613602LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB30 Polyclonal Antibody, HRP Conjugated

A50890 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAB30 Polyclonal Antibody, FITC Conjugated

A50891 100 µg
EUR 570.55
Description: fast delivery possible

RAB30 Polyclonal Antibody, Biotin Conjugated

A50892 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal RAB30 Antibody - C-terminal region

AMM07464G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB30 - C-terminal region. This antibody is tested and proven to work in the following applications:

RAB30 Conjugated Antibody

C46182 100ul
EUR 397

RAB30 Antibody (HRP)

20-abx306784
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB30 Antibody (FITC)

20-abx306785
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB30 Antibody (Biotin)

20-abx306786
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RAB30 antibody

STJ191279 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB30

RAB30 siRNA

20-abx930638
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB30 siRNA

20-abx930639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB30 Antibody, HRP conjugated

1-CSB-PA613602LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB30 Antibody, FITC conjugated

1-CSB-PA613602LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB30 Antibody, Biotin conjugated

1-CSB-PA613602LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB30 cloning plasmid

CSB-CL613602HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaa
  • Show more
Description: A cloning plasmid for the RAB30 gene.

RAB30 Rabbit Polyclonal Antibody