RAB30 Rabbit Polyclonal Antibody

RAB30 Polyclonal Antibody
ABP60065-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody
ABP60065-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody
A50889	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RAB30 Antibody
ABD9824	Lifescience Market	100 ug	EUR 438

RAB30 antibody
70R-50949	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal RAB30 antibody

RAB30 Antibody
46182-100ul	SAB	100ul	EUR 252

RAB30 Antibody
46182-50ul	SAB	50ul	EUR 187

RAB30 Antibody
DF9824	Affbiotech	200ul	EUR 304
Description: RAB30 Antibody detects endogenous levels of total RAB30.

RAB30 Antibody
1-CSB-PA613602LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB30 Polyclonal Antibody, HRP Conjugated
A50890	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RAB30 Polyclonal Antibody, FITC Conjugated
A50891	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RAB30 Polyclonal Antibody, Biotin Conjugated
A50892	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Polyclonal RAB30 Antibody - C-terminal region
AMM07464G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB30 - C-terminal region. This antibody is tested and proven to work in the following applications:

RAB30 Conjugated Antibody
C46182	SAB	100ul	EUR 397

RAB30 Antibody (HRP)
20-abx306784	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB30 Antibody (FITC)
20-abx306785	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB30 Antibody (Biotin)
20-abx306786	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-RAB30 antibody
STJ191279	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RAB30

RAB30 siRNA
20-abx930638	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB30 siRNA
20-abx930639	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB30 Antibody, HRP conjugated
1-CSB-PA613602LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB30 Antibody, FITC conjugated
1-CSB-PA613602LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB30 Antibody, Biotin conjugated
1-CSB-PA613602LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB30 cloning plasmid
CSB-CL613602HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 612 Sequence: atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaa Show more
Description: A cloning plasmid for the RAB30 gene.

RAB30 Rabbit Polyclonal Antibody