RALB Rabbit Polyclonal Antibody

RALB Polyclonal Antibody

ABP60083-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RALB protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RALB from Human, Mouse, Rat. This RALB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RALB protein at amino acid sequence of 80-160

RALB Rabbit pAb

A4069-100ul 100 ul
EUR 308

RALB Rabbit pAb

A4069-200ul 200 ul
EUR 459

RALB Rabbit pAb

A4069-20ul 20 ul
EUR 183

RALB Rabbit pAb

A4069-50ul 50 ul
EUR 223

RALB Rabbit pAb

A6714-100ul 100 ul
EUR 308

RALB Rabbit pAb

A6714-200ul 200 ul
EUR 459

RALB Rabbit pAb

A6714-20ul 20 ul
EUR 183

RALB Rabbit pAb

A6714-50ul 50 ul
EUR 223

RALB Antibody

ABD9839 100 ug
EUR 438

RALB antibody

70R-50305 100 ul
EUR 244
Description: Purified Polyclonal RALB antibody

RALB antibody

70R-4028 50 ug
EUR 467
Description: Rabbit polyclonal RALB antibody

RALB antibody

39125-100ul 100ul
EUR 252

RALB Antibody

31152-100ul 100ul
EUR 252

RALB Antibody

31152-50ul 50ul
EUR 187

RALB antibody

22306-100ul 100ul
EUR 390

RALB antibody

70R-19755 50 ul
EUR 435
Description: Rabbit polyclonal RALB antibody

RALB antibody

70R-13249 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RALB antibody

RALB Antibody

DF9839 200ul
EUR 304
Description: RALB Antibody detects endogenous levels of total RALB.

RALB Antibody

1-CSB-PA283609
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:500-1:5000, WB:1:500-1:2000

RALB Antibody

1-CSB-PA219431
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

RALB Antibody

1-CSB-PA019297ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RALB Antibody

1-CSB-PA019297GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Ralb Antibody - middle region

APR01321G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ralb - middle region. This antibody is tested and proven to work in the following applications:

RALB Conjugated Antibody

C39125 100ul
EUR 397

RALB Conjugated Antibody

C31152 100ul
EUR 397

anti- RALB antibody

FNab07094 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: v-ral simian leukemia viral oncogene homolog B (ras related
  • GTP binding protein)
  • Uniprot ID: P11234
  • Gene ID: 5899
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against RALB

Anti-RALB Antibody

PB9795 100ug/vial
EUR 294

Anti-RALB antibody

PAab07094 100 ug
EUR 412

Anti-RALB antibody

STJ28797 100 µl
EUR 277
Description: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors.

Anti-RALB antibody

STJ116230 100 µl
EUR 277
Description: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors.

Anti-RALB antibody

STJ191295 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RALB

RALB siRNA

20-abx904455
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RALB siRNA

20-abx930822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RALB siRNA

20-abx930823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RALB

YF-PA14289 50 ul
EUR 363
Description: Mouse polyclonal to RALB

anti-RALB

YF-PA14290 50 ug
EUR 363
Description: Mouse polyclonal to RALB

anti-RALB

YF-PA14291 100 ug
EUR 403
Description: Rabbit polyclonal to RALB

RALB cloning plasmid

CSB-CL019297HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atggctgccaacaagagtaagggccagagctccttggccctccacaaggtgatcatggttggcagcggaggcgttggcaagtcagccctgacgcttcagttcatgtatgacgagtttgtagaagactatgaacctaccaaagctgacagttatagaaagaaagtggttcttgatgg
  • Show more
Description: A cloning plasmid for the RALB gene.

RALB Blocking Peptide

20-abx063180
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RALB Rabbit Polyclonal Antibody