RALB Polyclonal Antibody |
ABP60083-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RALB protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of RALB from Human, Mouse, Rat. This RALB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RALB protein at amino acid sequence of 80-160 |
RALB Rabbit pAb |
A4069-100ul |
Abclonal |
100 ul |
EUR 308 |
RALB Rabbit pAb |
A4069-200ul |
Abclonal |
200 ul |
EUR 459 |
RALB Rabbit pAb |
A4069-20ul |
Abclonal |
20 ul |
EUR 183 |
RALB Rabbit pAb |
A4069-50ul |
Abclonal |
50 ul |
EUR 223 |
RALB Rabbit pAb |
A6714-100ul |
Abclonal |
100 ul |
EUR 308 |
RALB Rabbit pAb |
A6714-200ul |
Abclonal |
200 ul |
EUR 459 |
RALB Rabbit pAb |
A6714-20ul |
Abclonal |
20 ul |
EUR 183 |
RALB Rabbit pAb |
A6714-50ul |
Abclonal |
50 ul |
EUR 223 |
RALB antibody |
70R-50305 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RALB antibody |
RALB antibody |
70R-4028 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RALB antibody |
RALB antibody |
39125-100ul |
SAB |
100ul |
EUR 252 |
RALB Antibody |
31152-100ul |
SAB |
100ul |
EUR 252 |
RALB Antibody |
31152-50ul |
SAB |
50ul |
EUR 187 |
RALB antibody |
22306-100ul |
SAB |
100ul |
EUR 390 |
RALB antibody |
70R-19755 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RALB antibody |
RALB antibody |
70R-13249 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal RALB antibody |
RALB Antibody |
DF9839 |
Affbiotech |
200ul |
EUR 304 |
Description: RALB Antibody detects endogenous levels of total RALB. |
RALB Antibody |
1-CSB-PA283609 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:500-1:5000, WB:1:500-1:2000 |
RALB Antibody |
1-CSB-PA219431 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:10-1:50 |
RALB Antibody |
1-CSB-PA019297ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RALB Antibody |
1-CSB-PA019297GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RALB. Recognizes RALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal Ralb Antibody - middle region |
APR01321G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ralb - middle region. This antibody is tested and proven to work in the following applications: |
RALB Conjugated Antibody |
C39125 |
SAB |
100ul |
EUR 397 |
RALB Conjugated Antibody |
C31152 |
SAB |
100ul |
EUR 397 |
anti- RALB antibody |
FNab07094 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: v-ral simian leukemia viral oncogene homolog B (ras related
- GTP binding protein)
- Uniprot ID: P11234
- Gene ID: 5899
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against RALB |
Anti-RALB Antibody |
PB9795 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-RALB antibody |
STJ28797 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors. |
Anti-RALB antibody |
STJ116230 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors. |
Anti-RALB antibody |
STJ191295 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RALB |
RALB siRNA |
20-abx904455 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RALB siRNA |
20-abx930822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RALB siRNA |
20-abx930823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RALB |
YF-PA14289 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RALB |
anti-RALB |
YF-PA14290 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RALB |
anti-RALB |
YF-PA14291 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to RALB |
RALB cloning plasmid |
CSB-CL019297HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 621
- Sequence: atggctgccaacaagagtaagggccagagctccttggccctccacaaggtgatcatggttggcagcggaggcgttggcaagtcagccctgacgcttcagttcatgtatgacgagtttgtagaagactatgaacctaccaaagctgacagttatagaaagaaagtggttcttgatgg
- Show more
|
Description: A cloning plasmid for the RALB gene. |
RALB Blocking Peptide |
20-abx063180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RALB Rabbit Polyclonal Antibody