RFPL2 Rabbit Polyclonal Antibody

RFPL2 Rabbit pAb
A14604-100ul	Abclonal	100 ul	EUR 308

RFPL2 Rabbit pAb
A14604-200ul	Abclonal	200 ul	EUR 459

RFPL2 Rabbit pAb
A14604-20ul	Abclonal	20 ul	EUR 183

RFPL2 Rabbit pAb
A14604-50ul	Abclonal	50 ul	EUR 223

RFPL2 Rabbit pAb
A7578-100ul	Abclonal	100 ul	EUR 308

RFPL2 Rabbit pAb
A7578-200ul	Abclonal	200 ul	EUR 459

RFPL2 Rabbit pAb
A7578-20ul	Abclonal	20 ul	EUR 183

RFPL2 Rabbit pAb
A7578-50ul	Abclonal	50 ul	EUR 223

RFPL2 Antibody
46198-100ul	SAB	100ul	EUR 252

RFPL2 Antibody
46198-50ul	SAB	50ul	EUR 187

RFPL2 Antibody
DF9850	Affbiotech	200ul	EUR 304
Description: RFPL2 Antibody detects endogenous levels of total RFPL2.

RFPL2 antibody
70R-3277	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RFPL2 antibody raised against the C terminal of RFPL2

RFPL2 Antibody
abx145085-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

RFPL2 Antibody
1-CSB-PA019599ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RFPL2. Recognizes RFPL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RFPL2 Antibody
1-CSB-PA019599ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RFPL2. Recognizes RFPL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RFPL2 Antibody
ABD9850	Lifescience Market	100 ug	EUR 438

RFPL2 Conjugated Antibody
C46198	SAB	100ul	EUR 397

Anti-RFPL2 antibody
STJ116814	St John's Laboratory	100 µl	EUR 277

Anti-RFPL2 antibody
STJ29715	St John's Laboratory	100 µl	EUR 277

Anti-RFPL2 antibody
STJ191312	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RFPL2

Polyclonal RFPL2 antibody - C-terminal region
APR13090G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RFPL2 - C-terminal region. This antibody is tested and proven to work in the following applications:

RFPL2 siRNA
20-abx931322	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal RFPL2 and RFPL3 Antibody (C-Term)
APR13089G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RFPL2 and RFPL3 (C-Term). This antibody is tested and proven to work in the following applications:

RFPL2 and RFPL3 Antibody
abx433225-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

RFPL2 Blocking Peptide
33R-9802	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RFPL2 antibody, catalog no. 70R-3277

RFPL2 Blocking Peptide
DF9850-BP	Affbiotech	1mg	EUR 195

RFPL2 cloning plasmid
CSB-CL019599HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 867 Sequence: atggctgcactcttccaagaagcaagcagctgtcccgtctgctcagactatctggaaaaaccaatgtccctggagtgtggatgcgccgtctgcctcaagtgcattaattcactgcagaaggagccccatggggaggatctactttgctgttgctcttccatggtctctcggaagaa Show more
Description: A cloning plasmid for the RFPL2 gene.

Anti-RFPL2 and RFPL3 antibody
STJ70315	St John's Laboratory	100 µg	EUR 260

Human RFPL2 shRNA Plasmid
20-abx957317	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RFPL2 Recombinant Protein (Human)
RP026236	ABM	100 ug	Ask for price

RFPL2 ORF Vector (Human) (pORF)
ORF008746	ABM	1.0 ug DNA	EUR 95

Ret Finger Protein-Like 2 (RFPL2) Antibody
20-abx007029	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ret Finger Protein-Like 2 (RFPL2) Antibody
20-abx218266	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ret Finger Protein-Like 2 (RFPL2) Antibody
20-abx321879	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Ret Finger Protein-Like 2 (RFPL2) Antibody
20-abx321880	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

RFPL2 sgRNA CRISPR Lentivector set (Human)
K1812401	ABM	3 x 1.0 ug	EUR 339

RFPL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1812402	ABM	1.0 ug DNA	EUR 154

RFPL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1812403	ABM	1.0 ug DNA	EUR 154

RFPL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1812404	ABM	1.0 ug DNA	EUR 154

RFPL2 Protein Vector (Human) (pPB-C-His)
PV034981	ABM	500 ng	EUR 329

RFPL2 Protein Vector (Human) (pPB-N-His)
PV034982	ABM	500 ng	EUR 329

RFPL2 Protein Vector (Human) (pPM-C-HA)
PV034983	ABM	500 ng	EUR 329

RFPL2 Protein Vector (Human) (pPM-C-His)
PV034984	ABM	500 ng	EUR 329

RFPL2 3'UTR GFP Stable Cell Line
TU069793	ABM	1.0 ml	EUR 1394

RFPL2 3'UTR Luciferase Stable Cell Line
TU019793	ABM	1.0 ml	EUR 1394

Human Ret finger protein- like 2, RFPL2 ELISA KIT
ELI-41092h	Lifescience Market	96 Tests	EUR 824

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

RFPL2 Rabbit Polyclonal Antibody