RGS20 Rabbit Polyclonal Antibody

RGS20 Polyclonal Antibody

ES10148-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS20 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS20 Rabbit pAb

A8167-100ul 100 ul
EUR 308

RGS20 Rabbit pAb

A8167-200ul 200 ul
EUR 459

RGS20 Rabbit pAb

A8167-20ul 20 ul
EUR 183

RGS20 Rabbit pAb

A8167-50ul 50 ul
EUR 223

Polyclonal RGS20 Antibody (Center)

AMM07590G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 (Center). This antibody is tested and proven to work in the following applications:

RGS20 antibody

70R-1129 100 ug
EUR 377
Description: Rabbit polyclonal RGS20 antibody raised against the N terminal of RGS20

RGS20 antibody

70R-1143 100 ug
EUR 377
Description: Rabbit polyclonal RGS20 antibody raised against the middle region of RGS20

RGS20 antibody

70R-19875 50 ul
EUR 435
Description: Rabbit polyclonal RGS20 antibody

RGS20 Antibody

46197-100ul 100ul
EUR 252

RGS20 Antibody

46197-50ul 50ul
EUR 187

RGS20 Antibody

DF9846 200ul
EUR 304
Description: RGS20 Antibody detects endogenous levels of total RGS20.

RGS20 antibody

70R-51346 100 ul
EUR 244
Description: Purified Polyclonal RGS20 antibody

RGS20 Antibody

1-CSB-PA019652ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200

RGS20 Antibody

1-CSB-PA019652GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RGS20 Antibody

ABD13235 100 ug
EUR 438

RGS20 Antibody

ABD9846 100 ug
EUR 438

Polyclonal RGS20 antibody - N-terminal region

AMM07592G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 - N-terminal region. This antibody is tested and proven to work in the following applications:

RGS20 Conjugated Antibody

C46197 100ul
EUR 397

Anti-RGS20 antibody

STJ110466 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RGS20 antibody

STJ191306 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS20

RGS20 siRNA

20-abx931406
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS20 siRNA

20-abx931407
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RGS20

YF-PA15737 50 ul
EUR 363
Description: Mouse polyclonal to RGS20

anti-RGS20

YF-PA15738 50 ug
EUR 363
Description: Mouse polyclonal to RGS20

anti-RGS20

YF-PA15739 100 ul
EUR 403
Description: Rabbit polyclonal to RGS20

anti-RGS20

YF-PA15740 100 ug
EUR 403
Description: Rabbit polyclonal to RGS20

anti-RGS20

YF-PA25140 50 ul
EUR 334
Description: Mouse polyclonal to RGS20

RGS20 Blocking Peptide

33R-4413 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1129

RGS20 Blocking Peptide

33R-6636 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1143

RGS20 Blocking Peptide

DF9846-BP 1mg
EUR 195

RGS20 Blocking Peptide

20-abx064221
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RGS20 cloning plasmid

CSB-CL019652HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagag
  • Show more
Description: A cloning plasmid for the RGS20 gene.

RGS20 cloning plasmid

CSB-CL019652HU2-10ug 10ug
EUR 313
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgcgcacggcggacggaggcgagccggccggggcttcctccccggccggcagggtggacggtgggctccagatgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaa
  • Show more
Description: A cloning plasmid for the RGS20 gene.

Anti-RGS20 (3E10)

YF-MA16449 100 ug
EUR 363
Description: Mouse monoclonal to RGS20

Mouse RGS20 shRNA Plasmid

20-abx975058
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RGS20 shRNA Plasmid

20-abx955649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS20 Recombinant Protein (Human)

RP026317 100 ug Ask for price

RGS20 Recombinant Protein (Human)

RP026320 100 ug Ask for price

RGS20 Recombinant Protein (Mouse)

RP167897 100 ug Ask for price

RGS20 Recombinant Protein (Mouse)

RP167900 100 ug Ask for price

RGS20 Recombinant Protein (Rat)

RP225953 100 ug Ask for price

Monoclonal RGS20 Antibody (monoclonal) (M04), Clone: 3E11

AMM07591G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RGS20 (monoclonal) (M04). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E

Rgs20 ORF Vector (Rat) (pORF)

ORF075319 1.0 ug DNA
EUR 506

RGS20 ORF Vector (Human) (pORF)

ORF008773 1.0 ug DNA
EUR 95

RGS20 ORF Vector (Human) (pORF)

ORF008774 1.0 ug DNA
EUR 95

Rgs20 ORF Vector (Mouse) (pORF)

ORF055967 1.0 ug DNA
EUR 506

Rgs20 ORF Vector (Mouse) (pORF)

ORF055968 1.0 ug DNA
EUR 506

Rabbit Regulator of G protein signaling 20(RGS20) ELISA kit

E04R0409-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 20(RGS20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Regulator of G protein signaling 20(RGS20) ELISA kit

E04R0409-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 20(RGS20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Regulator of G protein signaling 20(RGS20) ELISA kit

E04R0409-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 20(RGS20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RGS20 Rabbit Polyclonal Antibody