RGS22 Rabbit Polyclonal Antibody

RGS22 Polyclonal Antibody

ES10150-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS22 Polyclonal Antibody

ES10150-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS22 Polyclonal Antibody

ABP60157-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400

RGS22 Polyclonal Antibody

ABP60157-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400

RGS22 Polyclonal Antibody

ABP60157-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400

RGS22 Polyclonal Antibody

A63326 100 µg
EUR 570.55
Description: reagents widely cited

RGS22 Antibody

ABD9848 100 ug
EUR 438

RGS22 antibody

70R-3489 50 ug
EUR 467
Description: Rabbit polyclonal RGS22 antibody raised against the N terminal of RGS22

RGS22 Antibody

42736-100ul 100ul
EUR 252

RGS22 Antibody

25527-100ul 100ul
EUR 390

RGS22 Antibody

DF9848 200ul
EUR 304
Description: RGS22 Antibody detects endogenous levels of total RGS22.

RGS22 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RGS22 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RGS22 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal RGS22 Antibody (N-Terminus)

AMM07595G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS22 (N-Terminus). This antibody is tested and proven to work in the following applications:

RGS22 Polyclonal Antibody, HRP Conjugated

A63327 100 µg
EUR 570.55
Description: Ask the seller for details

RGS22 Polyclonal Antibody, FITC Conjugated

A63328 100 µg
EUR 570.55
Description: The best epigenetics products

RGS22 Polyclonal Antibody, Biotin Conjugated

A63329 100 µg
EUR 570.55
Description: kits suitable for this type of research

RGS22 Conjugated Antibody

C42736 100ul
EUR 397

RGS22 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RGS22 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RGS22 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RGS22 antibody

STJ191308 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS22


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS22 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGS22 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGS22 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGS22 cloning plasmid

CSB-CL019654HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atgcccgagaagaggctcaccgcggagccaccaactattacagaagaagaatttgaagattctctggcaacagatgatttccttgtagactactttaatgaattcctaagccttccaaccttttcagaggcaattagatttaatgcagattatggagtttttgaagtagctaatg
  • Show more
Description: A cloning plasmid for the RGS22 gene.

RGS22 cloning plasmid

CSB-CL019654HU2-10ug 10ug
EUR 1336
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3795
  • Show more
Description: A cloning plasmid for the RGS22 gene.

RGS22 Blocking Peptide

33R-7764 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS22 antibody, catalog no. 70R-3489

RGS22 Blocking Peptide

DF9848-BP 1mg
EUR 195

Mouse RGS22 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RGS22 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS22 ORF Vector (Human) (pORF)

ORF008775 1.0 ug DNA
EUR 95

Rgs22 ORF Vector (Mouse) (pORF)

ORF055969 1.0 ug DNA
EUR 506

RGS22 ORF Vector (Human) (pORF)

ORF014283 1.0 ug DNA
EUR 354

pECMV-Rgs22-m-FLAG Plasmid

PVT15532 2 ug
EUR 325

Regulator of G Protein Signaling 22 (RGS22) Antibody

abx218279-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 22 (RGS22) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 22 (RGS22) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 22 (RGS22) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RGS22 sgRNA CRISPR Lentivector set (Human)

K1818801 3 x 1.0 ug
EUR 339

Rgs22 sgRNA CRISPR Lentivector set (Mouse)

K3032601 3 x 1.0 ug
EUR 339

RGS22 sgRNA CRISPR Lentivector (Human) (Target 1)

K1818802 1.0 ug DNA
EUR 154

RGS22 sgRNA CRISPR Lentivector (Human) (Target 2)

K1818803 1.0 ug DNA
EUR 154

RGS22 sgRNA CRISPR Lentivector (Human) (Target 3)

K1818804 1.0 ug DNA
EUR 154

Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3032602 1.0 ug DNA
EUR 154

Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3032603 1.0 ug DNA
EUR 154

Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3032604 1.0 ug DNA
EUR 154

RGS22 Protein Vector (Human) (pPB-C-His)

PV057129 500 ng
EUR 481

RGS22 Protein Vector (Human) (pPB-N-His)

PV057130 500 ng
EUR 481

RGS22 Protein Vector (Human) (pPM-C-HA)

PV057131 500 ng
EUR 481

RGS22 Rabbit Polyclonal Antibody