RGS22 Polyclonal Antibody |
A63326 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
RGS22 Polyclonal Antibody |
ABP60157-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
- Applications tips:
|
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400 |
RGS22 Polyclonal Antibody |
ABP60157-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
- Applications tips:
|
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400 |
RGS22 Polyclonal Antibody |
ABP60157-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400
- Applications tips:
|
Description: A polyclonal antibody for detection of RGS22 from Human. This RGS22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS22 protein at amino acid sequence of 320-400 |
RGS22 Polyclonal Antibody |
ES10150-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RGS22 Polyclonal Antibody |
ES10150-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RGS22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RGS22 Antibody |
25527-100ul |
SAB |
100ul |
EUR 390 |
RGS22 Antibody |
42736-100ul |
SAB |
100ul |
EUR 252 |
RGS22 Antibody |
1-CSB-PA090738 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
RGS22 Antibody |
DF9848 |
Affbiotech |
200ul |
EUR 304 |
Description: RGS22 Antibody detects endogenous levels of total RGS22. |
RGS22 Antibody |
1-CSB-PA276672 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
RGS22 antibody |
70R-3489 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RGS22 antibody raised against the N terminal of RGS22 |
RGS22 Antibody |
1-CSB-PA019654LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
Polyclonal RGS22 Antibody (N-Terminus) |
AMM07595G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS22 (N-Terminus). This antibody is tested and proven to work in the following applications: |
RGS22 Polyclonal Antibody, HRP Conjugated |
A63327 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
RGS22 Polyclonal Antibody, FITC Conjugated |
A63328 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RGS22 Polyclonal Antibody, Biotin Conjugated |
A63329 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RGS22 Conjugated Antibody |
C42736 |
SAB |
100ul |
EUR 397 |
RGS22 Antibody (HRP) |
20-abx305116 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RGS22 Antibody (FITC) |
20-abx305117 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RGS22 Antibody (Biotin) |
20-abx305118 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-RGS22 antibody |
STJ191308 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RGS22 |
RGS22 siRNA |
20-abx931409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS22 siRNA |
20-abx931410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS22 Antibody, HRP conjugated |
1-CSB-PA019654LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RGS22 Antibody, FITC conjugated |
1-CSB-PA019654LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RGS22 Antibody, Biotin conjugated |
1-CSB-PA019654LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RGS22. Recognizes RGS22 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RGS22 Blocking Peptide |
33R-7764 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS22 antibody, catalog no. 70R-3489 |
RGS22 Blocking Peptide |
DF9848-BP |
Affbiotech |
1mg |
EUR 195 |
RGS22 cloning plasmid |
CSB-CL019654HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1515
- Sequence: atgcccgagaagaggctcaccgcggagccaccaactattacagaagaagaatttgaagattctctggcaacagatgatttccttgtagactactttaatgaattcctaagccttccaaccttttcagaggcaattagatttaatgcagattatggagtttttgaagtagctaatg
- Show more
|
Description: A cloning plasmid for the RGS22 gene. |
RGS22 cloning plasmid |
CSB-CL019654HU2-10ug |
Cusabio |
10ug |
EUR 1336 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3795
- Sequence: ATGCCCGAGAAGAGGCTCACCGCGGAGCCACCAACTATTACAGAAGAAGAATTTGAAGATTCTCTGGCAACAGATGATTTCCTTGTAGACTACTTTAATGAATTCCTAAGCCTTCCAACCTTTTCAGAGGCAATTAGATTTAATGCAGATTATGGAGTTTTTGAAGTAGCTAATG
- Show more
|
Description: A cloning plasmid for the RGS22 gene. |
Mouse RGS22 shRNA Plasmid |
20-abx984185 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RGS22 shRNA Plasmid |
20-abx958745 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RGS22 ORF Vector (Human) (pORF) |
ORF014283 |
ABM |
1.0 ug DNA |
EUR 354 |
RGS22 ORF Vector (Human) (pORF) |
ORF008775 |
ABM |
1.0 ug DNA |
EUR 95 |
Rgs22 ORF Vector (Mouse) (pORF) |
ORF055969 |
ABM |
1.0 ug DNA |
EUR 506 |
Regulator of G Protein Signaling 22 (RGS22) Antibody |
abx218279-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Regulator Of G Protein Signaling 22 (RGS22) Antibody |
20-abx211144 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Regulator Of G Protein Signaling 22 (RGS22) Antibody |
20-abx210557 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Regulator of G Protein Signaling 22 (RGS22) Antibody |
20-abx305115 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RGS22 sgRNA CRISPR Lentivector set (Human) |
K1818801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rgs22 sgRNA CRISPR Lentivector set (Mouse) |
K3032601 |
ABM |
3 x 1.0 ug |
EUR 339 |
RGS22 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1818802 |
ABM |
1.0 ug DNA |
EUR 154 |
RGS22 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1818803 |
ABM |
1.0 ug DNA |
EUR 154 |
RGS22 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1818804 |
ABM |
1.0 ug DNA |
EUR 154 |
Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3032602 |
ABM |
1.0 ug DNA |
EUR 154 |
Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3032603 |
ABM |
1.0 ug DNA |
EUR 154 |
Rgs22 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3032604 |
ABM |
1.0 ug DNA |
EUR 154 |
RGS22 Protein Vector (Human) (pPB-C-His) |
PV035097 |
ABM |
500 ng |
EUR 329 |
RGS22 Protein Vector (Human) (pPB-N-His) |
PV035098 |
ABM |
500 ng |
EUR 329 |
RGS22 Protein Vector (Human) (pPM-C-HA) |
PV035099 |
ABM |
500 ng |
EUR 329 |
RGS22 Rabbit Polyclonal Antibody