Biocat Net

Amine biocat 3.0

RGS4 Rabbit Polyclonal Antibody

RGS4 Polyclonal Antibody

ABP60158-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGS4 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RGS4 from Human, Mouse, Rat. This RGS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS4 protein at amino acid sequence of 80-160

RGS4 Polyclonal Antibody

ES10151-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGS4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS4 Polyclonal Antibody

ES10151-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS4 Rabbit pAb

A1787-100ul 100 ul
EUR 308

RGS4 Rabbit pAb

A1787-200ul 200 ul
EUR 459

RGS4 Rabbit pAb

A1787-20ul 20 ul
EUR 183

RGS4 Rabbit pAb

A1787-50ul 50 ul
EUR 223

RGS4 Rabbit pAb

A16423-100ul 100 ul
EUR 308

RGS4 Rabbit pAb

A16423-200ul 200 ul
EUR 459

RGS4 Rabbit pAb

A16423-20ul 20 ul
EUR 183

RGS4 Rabbit pAb

A16423-50ul 50 ul
EUR 223

RGS4 antibody

22897-100ul 100ul
EUR 390

RGS4 antibody

70R-13592 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RGS4 antibody

RGS4 antibody

70R-19877 50 ul
EUR 435
Description: Rabbit polyclonal RGS4 antibody

RGS4 Antibody

42733-100ul 100ul
EUR 252

RGS4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RGS4 Antibody

DF9849 200ul
EUR 304
Description: RGS4 Antibody detects endogenous levels of total RGS4.

RGS4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RGS4 antibody

70R-51324 100 ul
EUR 244
Description: Purified Polyclonal RGS4 antibody

RGS4 antibody

70R-5834 50 ug
EUR 467
Description: Rabbit polyclonal RGS4 antibody raised against the C terminal of RGS4

RGS4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RGS4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RGS4 Antibody

ABD9849 100 ug
EUR 438

Rabbit RGS4 ELISA Kit

ERTR0046 96Tests
EUR 521

RGS4 Polyclonal Antibody, HRP Conjugated

A63331 100 µg
EUR 570.55
Description: kits suitable for this type of research

RGS4 Polyclonal Antibody, FITC Conjugated

A63332 100 µg
EUR 570.55
Description: fast delivery possible

RGS4 Polyclonal Antibody, Biotin Conjugated

A63333 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal RGS4 antibody - C-terminal region

APR00579G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS4 - C-terminal region. This antibody is tested and proven to work in the following applications:

RGS4 Conjugated Antibody

C42733 100ul
EUR 397

anti- RGS4 antibody

FNab07271 100µg
EUR 548.75
  • Immunogen: regulator of G-protein signaling 4
  • Uniprot ID: P49798
  • Gene ID: 5999
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against RGS4

Anti-RGS4 antibody

PAab07271 100 ug
EUR 386

Anti-RGS4 antibody

STJ118863 100 µl
EUR 277

Anti-RGS4 antibody

STJ119881 100 µl
EUR 277
Description: Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene.

Anti-RGS4 antibody

STJ191309 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS4

Rgs4/ Rat Rgs4 ELISA Kit

ELI-14409r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGS4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGS4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGS4 Blocking Peptide

33R-2276 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS4 antibody, catalog no. 70R-5834

RGS4 Blocking Peptide

DF9849-BP 1mg
EUR 195

RGS4 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RGS4 cloning plasmid

CSB-CL019656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtgcaaagggcttgcaggtctgccggcttcttgcttgaggagtgcaaaagatatgaaacatcggctaggtttcctgctgcaaaaatctgattcctgtgaacacaattcttcccacaacaagaaggacaaagtggttatttgccagagagtgagccaagaggaagtcaagaaatg
  • Show more
Description: A cloning plasmid for the RGS4 gene.

pENTR223-RGS4 vector

PVT11964 2 ug
EUR 308

Anti-RGS4 (2B2)

YF-MA15189 100 ug
EUR 363
Description: Mouse monoclonal to RGS4

RGS4 protein (His tag)

80R-1921 50 ug
EUR 305
Description: Purified recombinant RGS4 protein

Human RGS4 ELISA Kit

EHR0046 96Tests
EUR 521

Bovine RGS4 ELISA Kit

EBR0046 96Tests
EUR 521

Anserini RGS4 ELISA Kit

EAR0046 96Tests
EUR 521

Chicken RGS4 ELISA Kit

ECKR0046 96Tests
EUR 521

Canine RGS4 ELISA Kit

ECR0046 96Tests
EUR 521


EGTR0046 96Tests
EUR 521

RGS4 Rabbit Polyclonal Antibody