Biocat Net

Amine biocat 3.0

RHOF Rabbit Polyclonal Antibody

RHOF Polyclonal Antibody

ABP60169-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RHOF from Human, Mouse. This RHOF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170

RHOF Polyclonal Antibody

ABP60169-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RHOF from Human, Mouse. This RHOF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170

RHOF Polyclonal Antibody

ES10174-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RHOF from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHOF Polyclonal Antibody

ES10174-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RHOF from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHOF Rabbit pAb

A4786-100ul 100 ul
EUR 308

RHOF Rabbit pAb

A4786-200ul 200 ul
EUR 459

RHOF Rabbit pAb

A4786-20ul 20 ul
EUR 183

RHOF Rabbit pAb

A4786-50ul 50 ul
EUR 223

RHOF antibody

70R-19888 50 ul
EUR 435
Description: Rabbit polyclonal RHOF antibody

RHOF antibody

70R-2863 50 ug
EUR 467
Description: Rabbit polyclonal RHOF antibody

RHOF Antibody

46210-100ul 100ul
EUR 252

RHOF Antibody

46210-50ul 50ul
EUR 187

RHOF Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RHOF Antibody

DF9866 200ul
EUR 304
Description: RHOF Antibody detects endogenous levels of total RHOF.

RHOF antibody

70R-51383 100 ul
EUR 244
Description: Purified Polyclonal RHOF antibody

RHOF Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RHOF Antibody

ABD9866 100 ug
EUR 438

RHOF Polyclonal Antibody, HRP Conjugated

A67391 100 µg
EUR 570.55
Description: fast delivery possible

RHOF Polyclonal Antibody, FITC Conjugated

A67392 100 µg
EUR 570.55
Description: reagents widely cited

RHOF Polyclonal Antibody, Biotin Conjugated

A67393 100 µg
EUR 570.55
Description: Ask the seller for details

RHOF Conjugated Antibody

C46210 100ul
EUR 397

anti- RHOF antibody

FNab07285 100µg
EUR 548.75
  • Immunogen: ras homolog gene family, member F(in filopodia)
  • Uniprot ID: Q9HBH0
  • Gene ID: 54509
  • Research Area: Signal Transduction
Description: Antibody raised against RHOF

Anti-RHOF antibody

PAab07285 100 ug
EUR 386

Anti-RHOF antibody

STJ116259 100 µl
EUR 277

Anti-RHOF antibody

STJ191332 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RHOF

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

abx224086-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

abx146458-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

abx028940-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

abx028940-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

abx237285-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19326 50 ug
EUR 363
Description: Mouse polyclonal to RhoF

RHOF Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RHOF Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RHOF Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RHOF Blocking Peptide

33R-2090 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOF antibody, catalog no. 70R-2863

RHOF Blocking Peptide

DF9866-BP 1mg
EUR 195

RHOF Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RHOF cloning plasmid

CSB-CL867192HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atggatgcccccggggccctggcccagaccgccgcccccggtccgggcaggaaggagctgaagatcgtgatcgtgggcgacggcggctgcggcaagacctcgctgctcatggtgtacagccagggctccttccccgagcactacgccccatcggtgttcgagaagtacacggccag
  • Show more
Description: A cloning plasmid for the RHOF gene.

Monoclonal RHOF Antibody, Clone: 1D4B6

AMR09754G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RHOF. The antibodies are raised in Mouse and are from clone 1D4B6. This antibody is applicable in WB, FC, E

Bovine Rho- related GTP- binding protein RhoF, RHOF ELISA KIT

ELI-18102b 96 Tests
EUR 928

Human Rho- related GTP- binding protein RhoF, RHOF ELISA KIT

ELI-18103h 96 Tests
EUR 824

Mouse Rho- related GTP- binding protein RhoF, Rhof ELISA KIT

ELI-41322m 96 Tests
EUR 865


EF002453 96 Tests
EUR 689

Mouse RHOF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RHOF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rhof Recombinant Protein (Human)

RP086790 100 ug Ask for price

Rhof Recombinant Protein (Mouse)

RP168029 100 ug Ask for price

RHOF ORF Vector (Human) (pORF)

ORF028931 1.0 ug DNA Ask for price

Rhof ORF Vector (Mouse) (pORF)

ORF056011 1.0 ug DNA
EUR 506

RHOF sgRNA CRISPR Lentivector set (Human)

K1821401 3 x 1.0 ug
EUR 339

Rhof sgRNA CRISPR Lentivector set (Mouse)

K3756601 3 x 1.0 ug
EUR 339

RHOF sgRNA CRISPR Lentivector (Human) (Target 1)

K1821402 1.0 ug DNA
EUR 154

RHOF sgRNA CRISPR Lentivector (Human) (Target 2)

K1821403 1.0 ug DNA
EUR 154

RHOF sgRNA CRISPR Lentivector (Human) (Target 3)

K1821404 1.0 ug DNA
EUR 154

Rhof sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3756602 1.0 ug DNA
EUR 154

Rhof sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3756603 1.0 ug DNA
EUR 154

Rhof sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3756604 1.0 ug DNA
EUR 154

Rhof Protein Vector (Human) (pPB-C-His)

PV115722 500 ng Ask for price

Rhof Protein Vector (Human) (pPB-N-His)

PV115723 500 ng Ask for price

Rhof Protein Vector (Human) (pPM-C-HA)

PV115724 500 ng Ask for price

Rhof Protein Vector (Human) (pPM-C-His)

PV115725 500 ng Ask for price

Rhof Protein Vector (Mouse) (pPB-C-His)

PV224042 500 ng
EUR 603

Rhof Protein Vector (Mouse) (pPB-N-His)

PV224043 500 ng
EUR 603

Rhof Protein Vector (Mouse) (pPM-C-HA)

PV224044 500 ng
EUR 603

Rhof Protein Vector (Mouse) (pPM-C-His)

PV224045 500 ng
EUR 603

Rhof 3'UTR Luciferase Stable Cell Line

TU117834 1.0 ml Ask for price

Rhof 3'UTR GFP Stable Cell Line

TU167834 1.0 ml Ask for price

RHOF 3'UTR GFP Stable Cell Line

TU069884 1.0 ml
EUR 1521

RHOF 3'UTR Luciferase Stable Cell Line

TU019884 1.0 ml
EUR 1521

Ras Homolog Family Member F, Filopodia Associated (RHOF) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras Homolog Family Member F, Filopodia Associated (RHOF) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RHOF Rabbit Polyclonal Antibody