 RHOF Polyclonal Antibody |
|
ABP60169-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RHOF from Human, Mouse. This RHOF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170 |
RHOF Polyclonal Antibody |
|
ABP60169-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RHOF from Human, Mouse. This RHOF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170 |
RHOF Polyclonal Antibody |
|
ABP60169-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RHOF from Human, Mouse. This RHOF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOF protein at amino acid sequence of 90-170 |
RHOF Polyclonal Antibody |
|
A67390 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 RHOF Rabbit pAb |
|
A4786-100ul |
Abclonal |
100 ul |
EUR 308 |
RHOF Rabbit pAb |
|
A4786-200ul |
Abclonal |
200 ul |
EUR 459 |
RHOF Rabbit pAb |
|
A4786-20ul |
Abclonal |
20 ul |
EUR 183 |
RHOF Rabbit pAb |
|
A4786-50ul |
Abclonal |
50 ul |
EUR 223 |
 RHOF antibody |
|
70R-51383 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RHOF antibody |
RHOF antibody |
|
70R-2863 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal RHOF antibody |
 RHOF Antibody |
|
46210-100ul |
SAB |
100ul |
EUR 252 |
RHOF Antibody |
|
46210-50ul |
SAB |
50ul |
EUR 187 |
RHOF antibody |
|
70R-19888 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RHOF antibody |
RHOF Antibody |
|
DF9866 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RHOF Antibody detects endogenous levels of total RHOF. |
RHOF Antibody |
|
1-CSB-PA867192LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RHOF Antibody |
|
1-CSB-PA019689GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 RHOF Polyclonal Antibody, HRP Conjugated |
|
A67391 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 RHOF Polyclonal Antibody, FITC Conjugated |
|
A67392 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 RHOF Polyclonal Antibody, Biotin Conjugated |
|
A67393 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 RHOF Conjugated Antibody |
|
C46210 |
SAB |
100ul |
EUR 397 |
 anti- RHOF antibody |
|
FNab07285 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: ras homolog gene family, member F(in filopodia)
- Uniprot ID: Q9HBH0
- Gene ID: 54509
- Research Area: Signal Transduction
|
|
Description: Antibody raised against RHOF |
 Anti-RHOF antibody |
|
STJ191332 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RHOF |
 Antibody) Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
abx146458-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
20-abx007775 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
20-abx003623 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
abx028940-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
abx028940-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
20-abx310986 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
20-abx218292 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
abx224086-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoF (RHOF) Antibody |
|
abx237285-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 RHOF siRNA |
|
20-abx931476 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RHOF siRNA |
|
20-abx931477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RhoF |
|
YF-PA19326 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to RhoF |
 RHOF Antibody, HRP conjugated |
|
1-CSB-PA867192LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RHOF Antibody, FITC conjugated |
|
1-CSB-PA867192LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RHOF Antibody, Biotin conjugated |
|
1-CSB-PA867192LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RHOF. Recognizes RHOF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 RHOF Blocking Peptide |
|
20-abx064258 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RHOF Blocking Peptide |
|
33R-2090 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOF antibody, catalog no. 70R-2863 |
 RHOF cloning plasmid |
|
CSB-CL867192HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 513
- Sequence: atggatgcccccggggccctggcccagaccgccgcccccggtccgggcaggaaggagctgaagatcgtgatcgtgggcgacggcggctgcggcaagacctcgctgctcatggtgtacagccagggctccttccccgagcactacgccccatcggtgttcgagaagtacacggccag
- Show more
|
|
Description: A cloning plasmid for the RHOF gene. |
RHOF Blocking Peptide |
|
DF9866-BP |
Affbiotech |
1mg |
EUR 195 |
 Monoclonal RHOF Antibody, Clone: 1D4B6 |
|
AMR09754G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human RHOF. The antibodies are raised in Mouse and are from clone 1D4B6. This antibody is applicable in WB, FC, E |
 Bovine Rho- related GTP- binding protein RhoF, RHOF ELISA KIT |
|
ELI-18102b |
Lifescience Market |
96 Tests |
EUR 928 |
 Human Rho- related GTP- binding protein RhoF, RHOF ELISA KIT |
|
ELI-18103h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Rho- related GTP- binding protein RhoF, Rhof ELISA KIT |
|
ELI-41322m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human RHOF shRNA Plasmid |
|
20-abx960102 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse RHOF shRNA Plasmid |
|
20-abx973549 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Rhof Recombinant Protein (Human) |
|
RP086790 |
ABM |
100 ug |
Ask for price |
) Rhof Recombinant Protein (Mouse) |
|
RP168029 |
ABM |
100 ug |
Ask for price |
 (pORF)) RHOF ORF Vector (Human) (pORF) |
|
ORF028931 |
ABM |
1.0 ug DNA |
Ask for price |
 (pORF)) Rhof ORF Vector (Mouse) (pORF) |
|
ORF056011 |
ABM |
1.0 ug DNA |
EUR 506 |
) RHOF sgRNA CRISPR Lentivector set (Human) |
|
K1821401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rhof sgRNA CRISPR Lentivector set (Mouse) |
|
K3756601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RHOF sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1821402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RHOF sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1821403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RHOF sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1821404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rhof sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3756602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rhof sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3756603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rhof sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3756604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) Rhof Protein Vector (Human) (pPB-C-His) |
|
PV115722 |
ABM |
500 ng |
Ask for price |
 (pPB-N-His)) Rhof Protein Vector (Human) (pPB-N-His) |
|
PV115723 |
ABM |
500 ng |
Ask for price |
 (pPM-C-HA)) Rhof Protein Vector (Human) (pPM-C-HA) |
|
PV115724 |
ABM |
500 ng |
Ask for price |
 (pPM-C-His)) Rhof Protein Vector (Human) (pPM-C-His) |
|
PV115725 |
ABM |
500 ng |
Ask for price |
 (pPB-C-His)) Rhof Protein Vector (Mouse) (pPB-C-His) |
|
PV224042 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) Rhof Protein Vector (Mouse) (pPB-N-His) |
|
PV224043 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) Rhof Protein Vector (Mouse) (pPM-C-HA) |
|
PV224044 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) Rhof Protein Vector (Mouse) (pPM-C-His) |
|
PV224045 |
ABM |
500 ng |
EUR 603 |
 Rhof 3'UTR GFP Stable Cell Line |
|
TU167834 |
ABM |
1.0 ml |
Ask for price |
 RHOF 3'UTR Luciferase Stable Cell Line |
|
TU019884 |
ABM |
1.0 ml |
EUR 1521 |
 Rhof 3'UTR Luciferase Stable Cell Line |
|
TU117834 |
ABM |
1.0 ml |
Ask for price |
 RHOF 3'UTR GFP Stable Cell Line |
|
TU069884 |
ABM |
1.0 ml |
EUR 1521 |
 Antibody (HRP)) Ras Homolog Family Member F, Filopodia Associated (RHOF) Antibody (HRP) |
|
20-abx310987 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Ras Homolog Family Member F, Filopodia Associated (RHOF) Antibody (FITC) |
|
20-abx310988 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RHOF Rabbit Polyclonal Antibody
