Biocat Net

Amine biocat 3.0

RHOJ Rabbit Polyclonal Antibody

RHOJ Polyclonal Antibody

ABP60170-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RHOJ protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of RHOJ from Human, Mouse. This RHOJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOJ protein at amino acid sequence of 30-110

RHOJ Polyclonal Antibody

ES10175-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RHOJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHOJ Polyclonal Antibody

ES10175-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RHOJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHOJ Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHOJ antibody

70R-4532 50 ug
EUR 467
Description: Rabbit polyclonal RHOJ antibody raised against the middle region of RHOJ

RHOJ Polyclonal Antibody, HRP Conjugated

A67495 100 µg
EUR 570.55
Description: Ask the seller for details

RHOJ Polyclonal Antibody, FITC Conjugated

A67496 100 µg
EUR 570.55
Description: The best epigenetics products

RHOJ Polyclonal Antibody, Biotin Conjugated

A67497 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-RHOJ antibody

STJ191333 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RHOJ

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody

abx026427-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody

abx026427-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody

abx145094-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RHOJ Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RHOJ Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RHOJ Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RHOJ Blocking Peptide

33R-4988 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOJ antibody, catalog no. 70R-4532

RHOJ cloning plasmid

CSB-CL872495HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgaactgcaaagagggaactgacagcagctgcggctgcaggggcaacgacgagaagaagatgttgaagtgtgtggtggtgggggacggtgccgtggggaaaacctgcctgctgatgagctacgccaacgacgccttcccagaggaatacgtgcccactgtgtttgaccactatgc
  • Show more
Description: A cloning plasmid for the RHOJ gene.

Anti-RHOJ (1E4)

YF-MA11605 100 ug
EUR 363
Description: Mouse monoclonal to RHOJ

Human Rho- related GTP- binding protein RhoJ, RHOJ ELISA KIT

ELI-30325h 96 Tests
EUR 824

Mouse Rho- related GTP- binding protein RhoJ, Rhoj ELISA KIT

ELI-30326m 96 Tests
EUR 865

Mouse RHOJ shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RHOJ shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RHOJ Recombinant Protein (Human)

RP026404 100 ug Ask for price

RHOJ Recombinant Protein (Mouse)

RP168038 100 ug Ask for price

RHOJ Recombinant Protein (Rat)

RP226055 100 ug Ask for price

Monoclonal RHOJ Antibody (monoclonal) (M01), Clone: 1E5

AMM07610G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RHOJ (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1E5. This antibody is applicable in WB and IF, E

Rhoj ORF Vector (Rat) (pORF)

ORF075353 1.0 ug DNA
EUR 506

RHOJ ORF Vector (Human) (pORF)

ORF008802 1.0 ug DNA
EUR 95

Rhoj ORF Vector (Mouse) (pORF)

ORF056014 1.0 ug DNA
EUR 506

Monoclonal TCL / RHOJ Antibody (clone 1D7), Clone: 1D7

AMM08134G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human TCL / RHOJ (clone 1D7). The antibodies are raised in Mouse and are from clone 1D7. This antibody is applicable in WB and IHC-P, IF

Rhoj sgRNA CRISPR Lentivector set (Rat)

K7150801 3 x 1.0 ug
EUR 339

RHOJ sgRNA CRISPR Lentivector set (Human)

K1821601 3 x 1.0 ug
EUR 339

Rhoj sgRNA CRISPR Lentivector set (Mouse)

K4094401 3 x 1.0 ug
EUR 339

Rhoj sgRNA CRISPR Lentivector (Rat) (Target 1)

K7150802 1.0 ug DNA
EUR 154

Rhoj sgRNA CRISPR Lentivector (Rat) (Target 2)

K7150803 1.0 ug DNA
EUR 154

Rhoj sgRNA CRISPR Lentivector (Rat) (Target 3)

K7150804 1.0 ug DNA
EUR 154

RHOJ sgRNA CRISPR Lentivector (Human) (Target 1)

K1821602 1.0 ug DNA
EUR 154

RHOJ sgRNA CRISPR Lentivector (Human) (Target 2)

K1821603 1.0 ug DNA
EUR 154

RHOJ sgRNA CRISPR Lentivector (Human) (Target 3)

K1821604 1.0 ug DNA
EUR 154

Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4094402 1.0 ug DNA
EUR 154

Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4094403 1.0 ug DNA
EUR 154

Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4094404 1.0 ug DNA
EUR 154

RHOJ Protein Vector (Rat) (pPB-C-His)

PV301410 500 ng
EUR 603

RHOJ Protein Vector (Rat) (pPB-N-His)

PV301411 500 ng
EUR 603

RHOJ Protein Vector (Rat) (pPM-C-HA)

PV301412 500 ng
EUR 603

RHOJ Protein Vector (Rat) (pPM-C-His)

PV301413 500 ng
EUR 603

RHOJ Protein Vector (Human) (pPB-C-His)

PV035205 500 ng
EUR 329

RHOJ Protein Vector (Human) (pPB-N-His)

PV035206 500 ng
EUR 329

RHOJ Protein Vector (Human) (pPM-C-HA)

PV035207 500 ng
EUR 329

RHOJ Protein Vector (Human) (pPM-C-His)

PV035208 500 ng
EUR 329

RHOJ Protein Vector (Mouse) (pPB-C-His)

PV224054 500 ng
EUR 603

RHOJ Protein Vector (Mouse) (pPB-N-His)

PV224055 500 ng
EUR 603

RHOJ Protein Vector (Mouse) (pPM-C-HA)

PV224056 500 ng
EUR 603

RHOJ Protein Vector (Mouse) (pPM-C-His)

PV224057 500 ng
EUR 603

Rhoj 3'UTR Luciferase Stable Cell Line

TU117837 1.0 ml Ask for price

Rhoj 3'UTR GFP Stable Cell Line

TU167837 1.0 ml Ask for price

Rhoj 3'UTR Luciferase Stable Cell Line

TU219411 1.0 ml Ask for price

Rhoj 3'UTR GFP Stable Cell Line

TU269411 1.0 ml Ask for price

RHOJ 3'UTR GFP Stable Cell Line

TU069887 1.0 ml
EUR 2333

RHOJ 3'UTR Luciferase Stable Cell Line

TU019887 1.0 ml
EUR 2333

RHOJ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV627457 1.0 ug DNA
EUR 514

RHOJ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV627461 1.0 ug DNA
EUR 514

RHOJ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV627462 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

RHOJ Rabbit Polyclonal Antibody