RHOQ Rabbit Polyclonal Antibody

RHOQ Rabbit pAb
A17401-100ul 100 ul Ask for price

RHOQ Rabbit pAb
A17401-200ul 200 ul Ask for price

RHOQ Rabbit pAb
A17401-20ul 20 ul Ask for price

RHOQ Rabbit pAb
A17401-50ul 50 ul
EUR 384

RHOQ Antibody
ABD7643 100 ug
EUR 438

RHOQ Antibody
45090-100ul 100ul
EUR 252

RHOQ Antibody
45090-50ul 50ul
EUR 187

RHOQ antibody
70R-19889 50 ul
EUR 435
Description: Rabbit polyclonal RHOQ antibody

RHOQ Antibody
DF7643 200ul
EUR 304
Description: RHOQ Antibody detects endogenous levels of total RHOQ.

RHOQ Antibody
1-CSB-PA019693GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RHOQ. Recognizes RHOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Rhoq/ Rat Rhoq ELISA Kit
ELI-45212r 96 Tests
EUR 886

RHOQ Conjugated Antibody
C45090 100ul
EUR 397

Anti-RHOQ antibody
STJ119523 50 µl
EUR 393
Description: NA

Anti-RHOQ antibody
STJ191335 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RHOQ

RHOQ siRNA
20-abx904571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHOQ siRNA
20-abx931484
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHOQ siRNA
20-abx931485
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoQ (RHOQ) Protein
20-abx262613
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RHOQ cloning plasmid
CSB-CL019693HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCT
  • Show more
Description: A cloning plasmid for the RHOQ gene.

RHOQ Blocking Peptide
DF7643-BP 1mg
EUR 195

pCMV-SPORT6-RHOQ
PVT14161 2 ug
EUR 495

Human Rho- related GTP- binding protein RhoQ, RHOQ ELISA KIT
ELI-18505h 96 Tests
EUR 824

Mouse Rho- related GTP- binding protein RhoQ, Rhoq ELISA KIT
ELI-38885m 96 Tests
EUR 865

Mouse RHOQ shRNA Plasmid
20-abx979628
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RHOQ shRNA Plasmid
20-abx987025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RHOQ shRNA Plasmid
20-abx958268
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RHOQ protein (His tag)
80R-2786 50 ug
EUR 322
Description: Purified recombinant RHOQ protein (His tag)

RhoQ Recombinant Protein (Human)
RP042877 100 ug Ask for price

RhoQ Recombinant Protein (Rat)
RP226058 100 ug Ask for price

RhoQ Recombinant Protein (Mouse)
RP168041 100 ug Ask for price

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human)
4-PAE328Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ)

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC
4-PAE328Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Biotinylated
4-PAE328Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Biotin.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Cy3
4-PAE328Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Cy3.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), FITC
4-PAE328Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with FITC.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), HRP
4-PAE328Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with HRP.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), PE
4-PAE328Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with PE.

Rhoq ORF Vector (Mouse) (pORF)
ORF056015 1.0 ug DNA
EUR 506

Rhoq ORF Vector (Rat) (pORF)
ORF075354 1.0 ug DNA
EUR 506

RHOQ ORF Vector (Human) (pORF)
ORF014293 1.0 ug DNA
EUR 354

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC-Cy7
4-PAE328Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC-Cy7.

Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx129116
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ras Homolog Gene Family, Member Q (RHOQ) Antibody
abx146452-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx218294
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RhoQ sgRNA CRISPR Lentivector set (Human)
K0004301 3 x 1.0 ug
EUR 339

Rhoq sgRNA CRISPR Lentivector set (Mouse)
K3253301 3 x 1.0 ug
EUR 339

Rhoq sgRNA CRISPR Lentivector set (Rat)
K6994901 3 x 1.0 ug
EUR 339

RhoQ sgRNA CRISPR Lentivector (Human) (Target 1)
K0004302 1.0 ug DNA
EUR 154

RhoQ sgRNA CRISPR Lentivector (Human) (Target 2)
K0004303 1.0 ug DNA
EUR 154

RhoQ sgRNA CRISPR Lentivector (Human) (Target 3)
K0004304 1.0 ug DNA
EUR 154

Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3253302 1.0 ug DNA
EUR 154

Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3253303 1.0 ug DNA
EUR 154

Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3253304 1.0 ug DNA
EUR 154

Rhoq sgRNA CRISPR Lentivector (Rat) (Target 1)
K6994902 1.0 ug DNA
EUR 154

Rhoq sgRNA CRISPR Lentivector (Rat) (Target 2)
K6994903 1.0 ug DNA
EUR 154

Rhoq sgRNA CRISPR Lentivector (Rat) (Target 3)
K6994904 1.0 ug DNA
EUR 154

RhoQ Protein Vector (Human) (pPB-C-His)
PV057169 500 ng
EUR 481

RhoQ Protein Vector (Human) (pPB-N-His)
PV057170 500 ng
EUR 481

RhoQ Protein Vector (Human) (pPM-C-HA)
PV057171 500 ng
EUR 481

RhoQ Protein Vector (Human) (pPM-C-His)
PV057172 500 ng
EUR 481

Recombinant Human RHOQ Protein, His, E.coli-10ug
QP13319-10ug 10ug
EUR 201

Recombinant Human RHOQ Protein, His, E.coli-1mg
QP13319-1mg 1mg
EUR 5251

Recombinant Human RHOQ Protein, His, E.coli-2ug
QP13319-2ug 2ug
EUR 155

RhoQ Protein Vector (Rat) (pPB-C-His)
PV301414 500 ng
EUR 603

RhoQ Protein Vector (Rat) (pPB-N-His)
PV301415 500 ng
EUR 603

RhoQ Protein Vector (Rat) (pPM-C-HA)
PV301416 500 ng
EUR 603

RhoQ Protein Vector (Rat) (pPM-C-His)
PV301417 500 ng
EUR 603

RhoQ Protein Vector (Mouse) (pPB-C-His)
PV224058 500 ng
EUR 603

RhoQ Protein Vector (Mouse) (pPB-N-His)
PV224059 500 ng
EUR 603

RhoQ Protein Vector (Mouse) (pPM-C-HA)
PV224060 500 ng
EUR 603

RhoQ Protein Vector (Mouse) (pPM-C-His)
PV224061 500 ng
EUR 603

Rhoq 3'UTR GFP Stable Cell Line
TU167838 1.0 ml Ask for price

RHOQ 3'UTR Luciferase Stable Cell Line
TU019888 1.0 ml
EUR 1521

Rhoq 3'UTR Luciferase Stable Cell Line
TU117838 1.0 ml Ask for price

RHOQ 3'UTR GFP Stable Cell Line
TU069888 1.0 ml
EUR 1521

Rhoq 3'UTR Luciferase Stable Cell Line
TU219412 1.0 ml Ask for price

Rhoq 3'UTR GFP Stable Cell Line
TU269412 1.0 ml Ask for price

RhoQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691249 1.0 ug DNA
EUR 514

RhoQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV691253 1.0 ug DNA
EUR 514

RhoQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV691254 1.0 ug DNA
EUR 514

RHOQ Rabbit Polyclonal Antibody