RHOQ Rabbit Polyclonal Antibody

RHOQ Rabbit pAb
A17401-100ul	Abclonal	100 ul	Ask for price

RHOQ Rabbit pAb
A17401-200ul	Abclonal	200 ul	Ask for price

RHOQ Rabbit pAb
A17401-20ul	Abclonal	20 ul	Ask for price

RHOQ Rabbit pAb
A17401-50ul	Abclonal	50 ul	EUR 384

RHOQ antibody
70R-19889	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RHOQ antibody

RHOQ Antibody
45090-100ul	SAB	100ul	EUR 252

RHOQ Antibody
45090-50ul	SAB	50ul	EUR 187

RHOQ Antibody
DF7643	Affbiotech	200ul	EUR 304
Description: RHOQ Antibody detects endogenous levels of total RHOQ.

RHOQ Antibody
1-CSB-PA019693GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RHOQ. Recognizes RHOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RHOQ Antibody
ABD7643	Lifescience Market	100 ug	EUR 438

Rhoq/ Rat Rhoq ELISA Kit
ELI-45212r	Lifescience Market	96 Tests	EUR 886

RHOQ Conjugated Antibody
C45090	SAB	100ul	EUR 397

Anti-RHOQ antibody
STJ119523	St John's Laboratory	50 µl	EUR 393
Description: NA

Anti-RHOQ antibody
STJ191335	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RHOQ

RHOQ siRNA
20-abx904571	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RHOQ siRNA
20-abx931484	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RHOQ siRNA
20-abx931485	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoQ (RHOQ) Protein
20-abx262613	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

RHOQ Blocking Peptide
DF7643-BP	Affbiotech	1mg	EUR 195

RHOQ cloning plasmid
CSB-CL019693HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 618 Sequence: ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCT Show more
Description: A cloning plasmid for the RHOQ gene.

pCMV-SPORT6-RHOQ
PVT14161	Lifescience Market	2 ug	EUR 495

Human Rho- related GTP- binding protein RhoQ, RHOQ ELISA KIT
ELI-18505h	Lifescience Market	96 Tests	EUR 824

Mouse Rho- related GTP- binding protein RhoQ, Rhoq ELISA KIT
ELI-38885m	Lifescience Market	96 Tests	EUR 865

RHOQ protein (His tag)
80R-2786	Fitzgerald	50 ug	EUR 322
Description: Purified recombinant RHOQ protein (His tag)

Rat RHOQ shRNA Plasmid
20-abx987025	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RHOQ shRNA Plasmid
20-abx958268	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RHOQ shRNA Plasmid
20-abx979628	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RhoQ Recombinant Protein (Human)
RP042877	ABM	100 ug	Ask for price

RhoQ Recombinant Protein (Mouse)
RP168041	ABM	100 ug	Ask for price

RhoQ Recombinant Protein (Rat)
RP226058	ABM	100 ug	Ask for price

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human)
4-PAE328Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ)

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC
4-PAE328Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Biotinylated
4-PAE328Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Biotin.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Cy3
4-PAE328Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Cy3.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), FITC
4-PAE328Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with FITC.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), HRP
4-PAE328Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with HRP.

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), PE
4-PAE328Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with PE.

Rhoq ORF Vector (Rat) (pORF)
ORF075354	ABM	1.0 ug DNA	EUR 506

RHOQ ORF Vector (Human) (pORF)
ORF014293	ABM	1.0 ug DNA	EUR 354

Rhoq ORF Vector (Mouse) (pORF)
ORF056015	ABM	1.0 ug DNA	EUR 506

Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC-Cy7
4-PAE328Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RHOQ (Met1~Cys202) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC-Cy7.

Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx218294	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx129116	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ras Homolog Gene Family, Member Q (RHOQ) Antibody
abx146452-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Rhoq sgRNA CRISPR Lentivector set (Rat)
K6994901	ABM	3 x 1.0 ug	EUR 339

Rhoq sgRNA CRISPR Lentivector set (Mouse)
K3253301	ABM	3 x 1.0 ug	EUR 339

RhoQ sgRNA CRISPR Lentivector set (Human)
K0004301	ABM	3 x 1.0 ug	EUR 339

Rhoq sgRNA CRISPR Lentivector (Rat) (Target 1)
K6994902	ABM	1.0 ug DNA	EUR 154

Rhoq sgRNA CRISPR Lentivector (Rat) (Target 2)
K6994903	ABM	1.0 ug DNA	EUR 154

Rhoq sgRNA CRISPR Lentivector (Rat) (Target 3)
K6994904	ABM	1.0 ug DNA	EUR 154

Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3253302	ABM	1.0 ug DNA	EUR 154

Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3253303	ABM	1.0 ug DNA	EUR 154

Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3253304	ABM	1.0 ug DNA	EUR 154

RhoQ sgRNA CRISPR Lentivector (Human) (Target 1)
K0004302	ABM	1.0 ug DNA	EUR 154

RhoQ sgRNA CRISPR Lentivector (Human) (Target 2)
K0004303	ABM	1.0 ug DNA	EUR 154

RhoQ sgRNA CRISPR Lentivector (Human) (Target 3)
K0004304	ABM	1.0 ug DNA	EUR 154

RhoQ Protein Vector (Rat) (pPB-C-His)
PV301414	ABM	500 ng	EUR 603

RhoQ Protein Vector (Rat) (pPB-N-His)
PV301415	ABM	500 ng	EUR 603

RhoQ Protein Vector (Rat) (pPM-C-HA)
PV301416	ABM	500 ng	EUR 603

RhoQ Protein Vector (Rat) (pPM-C-His)
PV301417	ABM	500 ng	EUR 603

RhoQ Protein Vector (Human) (pPB-C-His)
PV057169	ABM	500 ng	EUR 481

RhoQ Protein Vector (Human) (pPB-N-His)
PV057170	ABM	500 ng	EUR 481

RhoQ Protein Vector (Human) (pPM-C-HA)
PV057171	ABM	500 ng	EUR 481

RhoQ Protein Vector (Human) (pPM-C-His)
PV057172	ABM	500 ng	EUR 481

RhoQ Protein Vector (Mouse) (pPB-C-His)
PV224058	ABM	500 ng	EUR 603

RhoQ Protein Vector (Mouse) (pPB-N-His)
PV224059	ABM	500 ng	EUR 603

RhoQ Protein Vector (Mouse) (pPM-C-HA)
PV224060	ABM	500 ng	EUR 603

RhoQ Protein Vector (Mouse) (pPM-C-His)
PV224061	ABM	500 ng	EUR 603

Recombinant Human RHOQ Protein, His, E.coli-10ug
QP13319-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human RHOQ Protein, His, E.coli-1mg
QP13319-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human RHOQ Protein, His, E.coli-2ug
QP13319-2ug	EnQuireBio	2ug	EUR 155

Rhoq 3'UTR Luciferase Stable Cell Line
TU117838	ABM	1.0 ml	Ask for price

Rhoq 3'UTR GFP Stable Cell Line
TU167838	ABM	1.0 ml	Ask for price

Rhoq 3'UTR Luciferase Stable Cell Line
TU219412	ABM	1.0 ml	Ask for price

Rhoq 3'UTR GFP Stable Cell Line
TU269412	ABM	1.0 ml	Ask for price

RHOQ 3'UTR GFP Stable Cell Line
TU069888	ABM	1.0 ml	EUR 1521

RHOQ 3'UTR Luciferase Stable Cell Line
TU019888	ABM	1.0 ml	EUR 1521

RhoQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691249	ABM	1.0 ug DNA	EUR 514

RhoQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV691253	ABM	1.0 ug DNA	EUR 514

RhoQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV691254	ABM	1.0 ug DNA	EUR 514

RHOQ Rabbit Polyclonal Antibody