RND1 Rabbit Polyclonal Antibody

RND1 Polyclonal Antibody
ABP60217-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RND1 protein at amino acid sequence of 140-220 Applications tips:
Description: A polyclonal antibody for detection of RND1 from Human, Mouse. This RND1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND1 protein at amino acid sequence of 140-220

RND1 Polyclonal Antibody
28315-100ul	SAB	100ul	EUR 252

RND1 Polyclonal Antibody
28315-50ul	SAB	50ul	EUR 187

RND1 Rabbit pAb
A13705-100ul	Abclonal	100 ul	EUR 308

RND1 Rabbit pAb
A13705-200ul	Abclonal	200 ul	EUR 459

RND1 Rabbit pAb
A13705-20ul	Abclonal	20 ul	EUR 183

RND1 Rabbit pAb
A13705-50ul	Abclonal	50 ul	EUR 223

RND1 Polyclonal Conjugated Antibody
C28315	SAB	100ul	EUR 397

RND1 Antibody
1-CSB-PA835694LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Polyclonal RND1 antibody - C-terminal region
AMM07634G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RND1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-RND1 Antibody
A06347	BosterBio	100ug/vial	EUR 294

Human RND1 Antibody
33296-05111	AssayPro	150 ug	EUR 261

Anti-RND1 antibody
STJ191330	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RND1

Anti-RND1 antibody
STJ115660	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that belongs to the Rho GTPase family. Members of this family regulate the organization of the actin cytoskeleton in response to extracellular growth factors. A similar protein in rat interacts with a microtubule regulator to control axon extension.

RND1 siRNA
20-abx931647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RND1 siRNA
20-abx931648	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pEGFP- Rnd1
PVT10198	Lifescience Market	2 ug	EUR 301

anti-RND1
YF-PA18451	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RND1

anti-RND1
YF-PA26055	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RND1

RND1 Antibody, HRP conjugated
1-CSB-PA835694LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RND1 Antibody, FITC conjugated
1-CSB-PA835694LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RND1 Antibody, Biotin conjugated
1-CSB-PA835694LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human)
4-PAB788Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1)

RND1 cloning plasmid
CSB-CL835694HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 699 Sequence: atgaaggagagacgggccccccagccagtcgtggccagatgtaagctcgttctggtcggggacgtgcagtgtgggaagaccgcgatgttgcaagtgttagcgaaggattgctatccagagacctatgtgcccaccgtgttcgaaaattacacagcctgtttggagacagaggaaca Show more
Description: A cloning plasmid for the RND1 gene.

pCDNA3.1- Flag- Rnd1
PVT10167	Lifescience Market	2 ug	EUR 301

Human RND1 Antibody (Biotin Conjugate)
33296-05121	AssayPro	150 ug	EUR 369

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), APC
4-PAB788Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with APC.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), Biotinylated
4-PAB788Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with Biotin.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), Cy3
4-PAB788Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with Cy3.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), FITC
4-PAB788Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with FITC.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), HRP
4-PAB788Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with HRP.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), PE
4-PAB788Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with PE.

Rabbit Rho Family GTPase 1 (RND1) ELISA Kit
abx362433-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse RND1 shRNA Plasmid
20-abx981301	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RND1 shRNA Plasmid
20-abx959056	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RND1 protein (His tag)
80R-1902	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant RND1 protein

RND1 Recombinant Protein (Human)
RP026542	ABM	100 ug	Ask for price

RND1 Recombinant Protein (Rat)
RP226265	ABM	100 ug	Ask for price

RND1 Recombinant Protein (Mouse)
RP168404	ABM	100 ug	Ask for price

Rho Family GTPase 1 (RND1) Antibody
20-abx130669	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rho Family GTPase 1 (RND1) Antibody
abx145149-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Human RND1 AssayLite Antibody (FITC Conjugate)
33296-05141	AssayPro	150 ug	EUR 428

Human RND1 AssayLite Antibody (RPE Conjugate)
33296-05151	AssayPro	150 ug	EUR 428

Human RND1 AssayLite Antibody (APC Conjugate)
33296-05161	AssayPro	150 ug	EUR 428

Human RND1 AssayLite Antibody (PerCP Conjugate)
33296-05171	AssayPro	150 ug	EUR 471

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), APC-Cy7
4-PAB788Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RND1 (Met1~Cys229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with APC-Cy7.

RND1 ORF Vector (Human) (pORF)
ORF008848	ABM	1.0 ug DNA	EUR 95

Rnd1 ORF Vector (Mouse) (pORF)
ORF056136	ABM	1.0 ug DNA	EUR 506

Rnd1 ORF Vector (Rat) (pORF)
ORF075423	ABM	1.0 ug DNA	EUR 506

RND1 sgRNA CRISPR Lentivector set (Human)
K1833501	ABM	3 x 1.0 ug	EUR 339

Rnd1 sgRNA CRISPR Lentivector set (Mouse)
K3616701	ABM	3 x 1.0 ug	EUR 339

Rnd1 sgRNA CRISPR Lentivector set (Rat)
K7333401	ABM	3 x 1.0 ug	EUR 339

Recombinant Rho Family GTPase 1 (RND1)
4-RPB788Hu01	Cloud-Clone	EUR 377.76 EUR 204.00 EUR 1141.60 EUR 447.20 EUR 794.40 EUR 316.00 EUR 2704.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q92730 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Rho Family GTPase 1 expressed in: E.coli

Human Rho Family GTPase 1 (RND1) Protein
20-abx168764	Abbexa	EUR 537.00 EUR 244.00 EUR 1553.00 EUR 634.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RND1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1833502	ABM	1.0 ug DNA	EUR 154

RND1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1833503	ABM	1.0 ug DNA	EUR 154

RND1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1833504	ABM	1.0 ug DNA	EUR 154

Rnd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3616702	ABM	1.0 ug DNA	EUR 154

Rnd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3616703	ABM	1.0 ug DNA	EUR 154

Rnd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3616704	ABM	1.0 ug DNA	EUR 154

Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7333402	ABM	1.0 ug DNA	EUR 154

Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7333403	ABM	1.0 ug DNA	EUR 154

Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7333404	ABM	1.0 ug DNA	EUR 154

RND1 Protein Vector (Human) (pPB-C-His)
PV035389	ABM	500 ng	EUR 329

RND1 Protein Vector (Human) (pPB-N-His)
PV035390	ABM	500 ng	EUR 329

RND1 Protein Vector (Human) (pPM-C-HA)
PV035391	ABM	500 ng	EUR 329

RND1 Protein Vector (Human) (pPM-C-His)
PV035392	ABM	500 ng	EUR 329

Recombinant Human RND1 Protein, His, E.coli-1mg
QP13327-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human RND1 Protein, His, E.coli-20ug
QP13327-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RND1 Protein, His, E.coli-5ug
QP13327-5ug	EnQuireBio	5ug	EUR 155

RND1 Protein Vector (Rat) (pPB-C-His)
PV301690	ABM	500 ng	EUR 603

RND1 Protein Vector (Rat) (pPB-N-His)
PV301691	ABM	500 ng	EUR 603

RND1 Protein Vector (Rat) (pPM-C-HA)
PV301692	ABM	500 ng	EUR 603

RND1 Protein Vector (Rat) (pPM-C-His)
PV301693	ABM	500 ng	EUR 603

RND1 Protein Vector (Mouse) (pPB-C-His)
PV224542	ABM	500 ng	EUR 603

RND1 Rabbit Polyclonal Antibody