RND1 Rabbit Polyclonal Antibody

RND1 Polyclonal Antibody

ABP60217-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RND1 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of RND1 from Human, Mouse. This RND1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND1 protein at amino acid sequence of 140-220

RND1 Polyclonal Antibody

ES10172-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RND1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RND1 Polyclonal Antibody

ES10172-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RND1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RND1 Rabbit pAb

A13705-100ul 100 ul
EUR 308

RND1 Rabbit pAb

A13705-200ul 200 ul
EUR 459

RND1 Rabbit pAb

A13705-20ul 20 ul
EUR 183

RND1 Rabbit pAb

A13705-50ul 50 ul
EUR 223

RND1 Polyclonal Conjugated Antibody

C28315 100ul
EUR 397

RND1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Polyclonal RND1 antibody - C-terminal region

AMM07634G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RND1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-RND1 Antibody

A06347 100ug/vial
EUR 294

Human RND1 Antibody

33296-05111 150 ug
EUR 261

Anti-RND1 antibody

STJ115660 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the Rho GTPase family. Members of this family regulate the organization of the actin cytoskeleton in response to extracellular growth factors. A similar protein in rat interacts with a microtubule regulator to control axon extension.

Anti-RND1 antibody

STJ191330 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RND1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pEGFP- Rnd1

PVT10198 2 ug
EUR 301


YF-PA18451 50 ug
EUR 363
Description: Mouse polyclonal to RND1


YF-PA26055 50 ul
EUR 334
Description: Mouse polyclonal to RND1

RND1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RND1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RND1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1)

RND1 cloning plasmid

CSB-CL835694HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 699
  • Sequence: atgaaggagagacgggccccccagccagtcgtggccagatgtaagctcgttctggtcggggacgtgcagtgtgggaagaccgcgatgttgcaagtgttagcgaaggattgctatccagagacctatgtgcccaccgtgttcgaaaattacacagcctgtttggagacagaggaaca
  • Show more
Description: A cloning plasmid for the RND1 gene.

pCDNA3.1- Flag- Rnd1

PVT10167 2 ug
EUR 301

Human RND1 Antibody (Biotin Conjugate)

33296-05121 150 ug
EUR 369

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with APC.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with Biotin.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with Cy3.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with FITC.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with HRP.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with PE.

Rabbit Rho Family GTPase 1 (RND1) ELISA Kit

abx362433-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

RND1 protein (His tag)

80R-1902 100 ug
EUR 305
Description: Purified recombinant RND1 protein

Human RND1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RND1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RND1 Recombinant Protein (Human)

RP026542 100 ug Ask for price

RND1 Recombinant Protein (Mouse)

RP168404 100 ug Ask for price

RND1 Recombinant Protein (Rat)

RP226265 100 ug Ask for price

Human RND1 AssayLite Antibody (FITC Conjugate)

33296-05141 150 ug
EUR 428

Human RND1 AssayLite Antibody (RPE Conjugate)

33296-05151 150 ug
EUR 428

Human RND1 AssayLite Antibody (APC Conjugate)

33296-05161 150 ug
EUR 428

Human RND1 AssayLite Antibody (PerCP Conjugate)

33296-05171 150 ug
EUR 471

Rho Family GTPase 1 (RND1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rho Family GTPase 1 (RND1) Antibody

abx145149-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RND1 (Met1~Cys229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with APC-Cy7.

Rnd1 ORF Vector (Rat) (pORF)

ORF075423 1.0 ug DNA
EUR 506

RND1 ORF Vector (Human) (pORF)

ORF008848 1.0 ug DNA
EUR 95

Rnd1 ORF Vector (Mouse) (pORF)

ORF056136 1.0 ug DNA
EUR 506

Rnd1 sgRNA CRISPR Lentivector set (Rat)

K7333401 3 x 1.0 ug
EUR 339

RND1 sgRNA CRISPR Lentivector set (Human)

K1833501 3 x 1.0 ug
EUR 339

Rnd1 sgRNA CRISPR Lentivector set (Mouse)

K3616701 3 x 1.0 ug
EUR 339

Recombinant Rho Family GTPase 1 (RND1)

  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92730
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Rho Family GTPase 1 expressed in: E.coli

Human Rho Family GTPase 1 (RND1) Protein

  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7333402 1.0 ug DNA
EUR 154

Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7333403 1.0 ug DNA
EUR 154

Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7333404 1.0 ug DNA
EUR 154

RND1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1833502 1.0 ug DNA
EUR 154

RND1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1833503 1.0 ug DNA
EUR 154

RND1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1833504 1.0 ug DNA
EUR 154

Rnd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3616702 1.0 ug DNA
EUR 154

Rnd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3616703 1.0 ug DNA
EUR 154

Rnd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3616704 1.0 ug DNA
EUR 154

RND1 Protein Vector (Rat) (pPB-C-His)

PV301690 500 ng
EUR 603

RND1 Protein Vector (Rat) (pPB-N-His)

PV301691 500 ng
EUR 603

RND1 Protein Vector (Rat) (pPM-C-HA)

PV301692 500 ng
EUR 603

RND1 Protein Vector (Rat) (pPM-C-His)

PV301693 500 ng
EUR 603

RND1 Protein Vector (Human) (pPB-C-His)

PV035389 500 ng
EUR 329

RND1 Protein Vector (Human) (pPB-N-His)

PV035390 500 ng
EUR 329

RND1 Protein Vector (Human) (pPM-C-HA)

PV035391 500 ng
EUR 329

RND1 Protein Vector (Human) (pPM-C-His)

PV035392 500 ng
EUR 329

RND1 Protein Vector (Mouse) (pPB-C-His)

PV224542 500 ng
EUR 603

RND1 Protein Vector (Mouse) (pPB-N-His)

PV224543 500 ng
EUR 603

RND1 Protein Vector (Mouse) (pPM-C-HA)

PV224544 500 ng
EUR 603

RND1 Protein Vector (Mouse) (pPM-C-His)

PV224545 500 ng
EUR 603

RND1 Rabbit Polyclonal Antibody